Skip to main content

Table 1 List of primers used for detection and characterization of beta-lactamases

From: Genetic markers associated with resistance to beta-lactam and quinolone antimicrobials in non-typhoidal Salmonella isolates from humans and animals in central Ethiopia

Gene/target Primer Sequence 5’-3’ Amplicon size AT °C Ref Remark
BLATem Gene TEM-F1 ATGAGTATTCAACATTTCCG 862-bp 55 [34]  
TEM-R1 GACAGTTACCAATGCTTAATCA
blaTEM-F2 TAA CCA TGAGTGATAACACT    [34] sequencing
blaTEM-R2 CCGATCGTT GTCAGAAGTAA
BLA SHV gene Bla SHV-F1 CTTTACTCGCCTTTATCG 827-bp 56 [34]  
Bla SHV-R1 TCCCGC AGATAAATCACCA
blaSHV-F2 ACTGCCTTTTTG CGCCAGAT    [34] sequencing
blaSHV-R2 CAGTTCCGTTTCCCAGCGGT
Bla OXA-1  OXA-1-F ATGAAAAACACAATACATATCAAC 755-bp 48 [13]  
OXA-1-R TTTCCTGTAAGTGCGGACAC
Bla OXA −4  OXA-4-F TCAACAGATATCTCTACTGGT 216 bp 54 [13]  
OXA-4-R TTTATCCCATTTGAATATG
Bla OXA-10 OXa 10-F TCAACAAATCGCCAGAGAAG 277 bp 57 [13]  
Oxa-10-R TCCCACACCAGAAAAACCA
bla PER Per1-F AATTTGGGCTTAGGGCAGAA 925 bp 55 [50]  
Per1-R ATGAATGTCATTATAAAAGC
blaPSE blaPSE-F TGCTTCGCAACTATGACTAC    [42]  
blaPSE-R AGCCTGTGTTTGAGCTAGAT
blaCYM blaCMY2-F TGGCCGTTGCCGTTATCTAC 868 57 [9]  
blaCMY2-R CCCGTTTATGCACCCATGA
CTX-M group I CTXM1-F3 GACGATGTCACTGGCTGAGC 499 55 [38]  
CTXM1-R2 AGCCGCCGACGCTAATACA
CTX-M group II TOHO1-2 F GCGACCTGGTTAACTACAATCC 351 55 [38]  
TOHO1-1R CGGTAGTATTGCCCTTAAGCC
CTX-M group III CTXM825F CGCTTT GCCATGTGCAGCACC 307 55 [38]  
CTXM825R GCT CAGTACGATCGAGCC
CTX-M group IV CTXM914F GCTGGAGAAAAGCAGCGGAG 474 62 [38]  
CTXM914R GTAAGCTGACGCAACGTCTG