Skip to main content

Table 2 List of primers used for detection of quinolone resistance mechanism

From: Genetic markers associated with resistance to beta-lactam and quinolone antimicrobials in non-typhoidal Salmonella isolates from humans and animals in central Ethiopia

Gene Primer name Primer sequence (5′ to 3′) Product size AT in °C References
gyrA GyrAFP AAATCTGCCCGTGTCGTTGGT 344 bp 58 [16]
GyrARP GCCATACCTACTGCGATACC
gyrB GyrB FP GAATACCTGCTGGAAAACCCAT 446 bp 57 [16]
GyrB RP CGGATGTGCGAGCCGTCGACGTCCGC
parC ParC FP AAGCCGGTACAGCGCCGCATC 395 bp 57 [16]
ParC RP GTGGTGCCGTTCAGCAGG
ParE ParE FP TCTCTTCCGATGAAGTGCTG 240 bp  55 [12]
ParE RP ATACGGTATAGCGGCGGTAG
qnrA qnrA FP ATTTCTCACGCCAGGATTTG 516 bp 53 [43]
qnrA RP GATCGGCAAAGGTTAGGTCA
qnrB qnrB FP GATCGTGAAAGCCAGAAAGG 469 bp 53 [43]
qnrB RP ACGATGCCTGGTAGTTGTCC
aac(6’)-Ib aac(6’)-Ib FP TTGCGATGCTCTATGAGTGGCTA 482-bp 55 [36]
aac(6’)-Ib-RP CTCGAATGCCTGGCGTGTTT
  aac(6’)-Ib-cr-seq CGTCACTCCATACATTGCAA (for sequencing of aac(6’)-Ib-cr    
qepA QepA FP CGTGTTGCTGGAGTTCTTC 403 bp 59 [7]
QepA RP CTGCAGGTACTGCGTCATG
QnrD QnrD FP CGAGATCAATTTACGGGGAATA 565 bp 53 [8]
QnrD RP AACAAGCTGAAGCGCCTG
QnrS QnrS FP ACGACATTCGTCAACTGCAA 417 bp 53 [43]
QnrS RP TAAATTGGCACCCTGTAGGC
  1. FP forward primer, RP Reverse primer