Skip to main content

Advertisement

Table 1 List of primer for detection of genes used in this study

From: Co-existence of bla OXA-23 and bla NDM-1 genes of Acinetobacter baumannii isolated from Nepal: antimicrobial resistance and clinical significance

Target genes Primer name Sequence 5’-3’ Size/ Annealing temp. References
16S rRNA 16S rRNA-F AGAGTTTGATCCTGGCTCAG 1500/58 [15]
  16S rRNA-R ACGGCTACCTTGTTACGACTT   
bla OXA-23 bla OXA-23-F GATCGGATTGGAGAACCAGA 501/52 [16]
  bla OXA-23-R ATTTCTGACCGCATTTCCAT   
bla OXA-51 bla OXA-51-F TAATGCTTTGATCGGCCTTG 353/52 [16]
  bla OXA-51-R TGGATTGCACTTCATCTTGG   
bla OXA-24 bla OXA-24-F GGTTAGTTGGCCCCCTTAAA 246/52 [16]
  bla OXA-24-R AGTTGAGCGAAAAGGGGATT   
bla OXA-58 bla OXA-58-F AAGTATTGGGGCTTGTGCTG 599/52 [16]
  bla OXA-58-R CCCCTCTGCGCTCTACATAC   
bla IMP bla IMP –F GGAATAGAGTGGCTTAAYTCTC 232/52 [20]
  bla IMP –R GGTTTAAYAAAACAACCACC   
bla VIM bla VIM –F GATGGTGTTTGGTCGCATA 390/52 [20]
  bla VIM –R CGAATGCGCAGCACCAG   
bla NDM bla NDM–F GGTTTGGCGATCTGGTTTTC 621/52 [21]
  bla NDM–R CGGAATGGCTCATCACGATC   
bla ADC bla ADC-F TAAACACCACATATGTTCCG 663/56 [19]
  bla ADC-F ACTTACTTCAACTCGCGACG   
aphA6 aphA6-F ATGGAATTGCCCAATATTATTC 736/55 [14]
  aphA6-R TCAATTCAATTCATCAAGTTTTA   
ISAba1 ISAba1-F CATTGGCATTAAACTGAGGAGAAA 451/52 [22]
  ISAba1-R TTGGAAATGGGGAAAACGAA   
ISAba125 ISA125-F TGTTGAAGCGATCCGTTGTT 755/57 This study
  ISA125-R GTGCGACAGTTTCAAAAGCCA   
Rep-PCR ERIC-2 AAGTAAGTGACTGGGGTGAGCG variable length/45 [24]