Skip to main content

Table 1 Primers used for PCR amplification and sequencing

From: Characterization of the novel In1059 harbouring VIM gene cassette

Primer Sequence (5′-3′) Length (bp) Reference
5′-CS F GGCATCCAAGCAGCAAGC Variable [40]
3′-CS R AAGCAGACTTGACCTGAT
Int1 F AGCACCTTGCCGTAGAAGAACAG 3500 This study
R GTCATAATCGGTTATGGCATCGC
intI1 F GGGTCAAGGATCTGGATTTCG 1250 [33]
R ACATGCGTGTAAATCATCGTCG
sul1 F ATGGTGACGGTGTTCGGCATTCTGA 900 [34]
R TCTGGCTCCCAATCTAGTACGGATC
qacEΔ1 F ATCGCAATAGTTGGCGAAGT 600 [35]
R CAAGCTTTTGCCCATGAAGC
aadA F ACATCATTCCGTGGCGTTATC 1100 This study
R TTATTTGCCGACTACCTTGGTGA
tnpA F GGCGGGATCTGCTTGTAGAG 920 [36]
R CTCCGGAGATGTCTGGCTTACT
aad B F TCACAGCCAAACTATCAGG 857 This study
R TGCTCCACCAATCACAAT
aacA4 F TGACCAACAGCAACGATTCC 800 [37]
R TTAGGCATCACTGCGTGTTC
bla OXA F ATGAAAAACACAATACATATCAACTTCGC 900 This study
R GTGTGTTTAGAATGGTGATCGCATT
bla KPC F TGTCACTGTATCGCCGTC 1000 [31]
R CTCAGTGCTCTACAGAAAACC
bla TEM F CTGTCTATTTCGTTCATCC 1061 [24]
R CTCAGTATTGCCCGCTCC
bla VIM F CACGAACCCAGTGGACATA 1512 This study
R TCACAGTAACCAGCAAATCA
bla IMP F GCACGAACCCAGTTGACATA 1394 This study
R GTTTCTTCTTCCCACCATCC
tniC F GCTCTGGTTGAGTTGGTG 993 This study
R GGATCCTTCCGCCTGTTG
dfr F GTGAAAATATCACTAATGG 750 [38]
R TTAACCCCTTTGCCAGATTTG
arr-3 F GGTGACTTGCTAACCACAG 450 This study
R ACAGTGACATAGCAAGTTCAG
catB F CCTGAAGATTGCCAAGAGTGGT 980 [39]
R AGTTTGTTCAGGGTGACGAAGG