Skip to main content

Table 1 Oligonucleotide primers used in this study

From: Genetic characterization of novel class 1 Integrons In0, In1069 and In1287 to In1290, and the inference of In1069-associated integron evolution in Enterobacteriaceae

Target Primer Primer sequence (5′-3′) Amplicon
length (bp)
Reference
bla KPC KPC-F GTATCGCCGTCTAGTTCTGC 637 [26]
KPC-R GGTCGTGTTTCCCTTTAGCC
bla IMP IMP-F GGAATAGAGTGGCTTAAYTCTC 232 [26]
IMP-R GGTTTAAYAAAACAACCACC
bla NDM NDM-F GGTTTGGCGATCTGGTTTTC 621 [26]
NDM-R CGGAATGGCTCATCACGATC
bla VIM VIM-F GATGGTGTTTGGTCGCATA 390 [26]
VIM-R CGAATGCGCAGCACCAG
bla OXA-23 OXA-23-F GATCGGATTGGAGAACCAGA 501 [27]
OXA-23-R ATTTCTGACCGCATTTCCAT
bla OXA-48 OXA-48-F TTGGTGGCATCGATTATCGG 744 [28]
OXA-48-R GAGCACTTCTTTTGTGATGGC
bla OXA-58 OXA-58-F AAGTATTGGGGCTTGTGCTG 599 [27]
OXA-58-R CCCCTCTGCGCTCTACATAC
aacA4 aacA4-F TATGAGTGGCTAAATCGAT 395 [23]
aacA4-R CCCGCTTTCTCGTAGCA
intI1 intI1-F GCTGAAAGGTCTGGTCATAC 515 This study
intI1-R GTTCTTCTACGGCAAGGTG
tniR tniR-F CCAGGGTTGGCTGCTTGC 375 This study
tniR-R1 ATCGCCCACCTTGGTTTCC
intI1 to tniR intI1-F GCTGAAAGGTCTGGTCATAC Variable This study
tniR-R2 ACGCTGATCGTGTGGAAG