Skip to main content

Table 1 Primes used in this study

From: Newest data on fluoroquinolone resistance mechanism of Shigella flexneri isolates in Jiangsu Province of China

Gene Sequence (5′–3′) Product size (bp) Annealing temperature (°C)
gyrA F: TACACCGGTCAACATTGAGG
R: TTAATGATTGCCGCCGTCGG
648 60
gyrB F: CAAACTGGCGGACTGTCAGG
R: TTCCGGCATCTGACGATAGA
345 60
parC F: GTCTGAACTGGGCCTGAATGC
R: AGCAGCTCGGAATATTTCGACAA
248 60
parE F: ATGCGTGCGGCTAAAAAAGTG
R: TCGTCGCTGTCAGGATCGATAC
289 60
qnrA F: ATTTCTCACGCCAGGATTTG
R: GATCGGCAAAGGTTAGGTCA
515 50
qnrB F: GATCGTGAAAGCCAGAAAGG
R: ACGATGCCTGGTAGTTGTCC
468 54
qnrC F: GGGTTGTACATTTATTGAATC
R: TCCACTTTACGAGGTTCT
446 50
qnrD F: CGAGATCAATTTACGGGGAATA
R: AACAAGCTGAAGCGCCTG
581 50
qnrS F: ACGACATTCGTCAACTGCAA
R: TAAATTGGCACCCTGTAGGC
416 55
aac(6′)-Ib-cr F: GCAACGCAAAAACAAAGTTAGG
R: GTGTTTGAACCATGTACA
560 55
qepA F: GCAGGTCCAGCAGCGGGTAG
R: CTTCCTGCCCGAGTATCGTG
217 60