Skip to main content

Table 1 The targeted genes, primer sequence and product size

From: Multiple drug resistance and biocide resistance in Escherichia coli environmental isolates from hospital and household settings

Target Detection primer Primer (sequence 5′ to 3′) Product size (bp) Reference
E. coli 16S rRNA 16 E1 (F) GGGAGTAAAGTTAATACCTTTGCTC 584 12
16 E2 (R) TTCCCGAAGGCACATTCT
16 E3 (R) TTCCCGAAGGCACCAATC
blaCTX-M group 1 CTX-M-7 (F) GCGTGATACCACTTAACCTC 260 13
CTX-M-8 (R) TGAAGTAAGTGACCAGAATC