Skip to main content

Advertisement

Table 1 Primers and PCR conditions used for characterization of virulence genes, O-serogroups and antibiotic resistance genes in the STEC strains isolated from raw milk and traditional dairy product samples

From: Prevalence, identification of virulence factors, O-serogroups and antibiotic resistance properties of Shiga-toxin producing Escherichia coli strains isolated from raw milk and traditional dairy products

Target gene Primer sequence (5′-3′) PCR product (bp) PCR programs PCR Volume (50 μL)
O157 F: CGGACATCCATGTGATATGG R: TTGCCTATGTACAGCTAATCC 259 1 cycle: 95 0C ------------ 3 min. 5 μL PCR buffer 10X 2 mM Mgcl2
O145 F: CCATCAACAGATTTAGGAGTG R: TTTCTACCGCGAATCTATC 609 30 cycle: 95 0C ------------ 20 s 58 0C ------------ 40 s 72 0C ------------ 30 s 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas)
O103 F: TTGGAGCGTTAACTGGACCT R: GCTCCCGAGCACGTATAAG 321
O26 F: CAGAATGGTTATGCTACTGT R: CTTACATTTGTTTTCGGCATC 423
O111 F: TAGAGAAATTATCAAGTTAGTTCC R: ATAGTTATGAACATCTTGTTTAGC 406 1 cycle: 72 0C ------------ 8 min 3 μL DNA template
O91 F: GCTGACCTTCATGATCTGTTGA R: TAATTTAACCCGTAGAATCGCTGC 291 1 cycle: 94 0C ------------ 6 min. 34 cycle: 95 0C ------------ 50 s 58 0C ------------ 70 s 72 0C ------------ 55 s 1 cycle: 72 0C ------------ 10 min 5 μL PCR buffer 10X 2 mM Mgcl2 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template
O128 F: GCTTTCTGCCGATATTTGGC R: CCGACGGACTGATGCCGGTGATT 289
O121 F: TGGCTAGTGGCATTCTGATG R: TGATACTTTAGCCGCCCTTG 322
O113 F: GGGTTAGATGGAGCGCTATTGAGA R: AGGTCACCCTCTGAATTATGGCAG 771
O45 F: CCGGGTTTCGATTTGTGAAGGTTG R: CACAACAGCCACTACTAGGCAGAA 527
stx1 F: AAATCGCCATTCGTTGACTACTTCT R: TGCCATTCTGGCAACTCGCGATGCA 366 1 cycle: 95 0C ------------ 3 min. 34 cycle: 94 0C ------------ 60 s 56 0C ------------ 45 s 72 0C ------------ 60 s 1 cycle: 72 0C ------------ 10 min 5 μL PCR buffer 10X 2 mM Mgcl2 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template
stx2 F: CGATCGTCACTCACTGGTTTCATCA R: GGATATTCTCCCCACTCTGACACC 282
eaeA F: TGCGGCACAACAGGCGGCGA R: CGGTCGCCGCACCAGGATTC 629
ehly F: CAATGCAGATGCAGATACCG R: CAGAGATGTCGTTGCAGCAG 432
aadA1 F: TATCCAGCTAAGCGCGAACT R: ATTTGCCGACTACCTTGGTC 447 1 cycle: 94 0C ------------ 8 min. 32 cycle: 95 0C ------------ 60 s 55 0C ------------ 70 s 72 0C ------------ 2 min 1 cycle: 72 0C ------------ 8 min 5 μL PCR buffer 10X 2 mM Mgcl2 150 μM dNTP (Fermentas) 0.75 μM of each primers F & R 1.5 U Taq DNA polymerase (Fermentas) 3 μL DNA template
tetA F: GGTTCACTCGAACGACGTCA R: CTGTCCGACAAGTTGCATGA 577
tetB F: CCTCAGCTTCTCAACGCGTG R: GCACCTTGCTGATGACTCTT 634
dfrA1 F: GGAGTGCCAAAGGTGAACAGC R: GAGGCGAAGTCTTGGGTAAAAAC 367
qnr F: GGGTATGGATATTATTGATAAAG R: CTAATCCGGCAGCACTATTTA 670
aac(3)-IV F: CTTCAGGATGGCAAGTTGGT R: TCATCTCGTTCTCCGCTCAT 286
sul1 F: TTCGGCATTCTGAATCTCAC R: ATGATCTAACCCTCGGTCTC 822
blaSHV F: TCGCCTGTGTATTATCTCCC R: CGCAGATAAATCACCACAATG 768
CITM F: TGGCCAGAACTGACAGGCAAA R: TTTCTCCTGAACGTGGCTGGC 462
cat1 F: AGTTGCTCAATGTACCTATAACC R: TTGTAATTCATTAAGCATTCTGCC 547
cmlA F: CCGCCACGGTGTTGTTGTTATC R: CACCTTGCCTGCCCATCATTAG 698