Skip to main content

Advertisement

Springer Nature is making Coronavirus research free. View research | View latest news | Sign up for updates

Table 1 Primers and PCR conditions used for characterization of virulence genes, O-serogroups and antibiotic resistance genes in the STEC strains isolated from raw milk and traditional dairy product samples

From: Prevalence, identification of virulence factors, O-serogroups and antibiotic resistance properties of Shiga-toxin producing Escherichia coli strains isolated from raw milk and traditional dairy products

Target gene Primer sequence (5′-3′) PCR product (bp) PCR programs PCR Volume (50 μL)
O157 F: CGGACATCCATGTGATATGG
R: TTGCCTATGTACAGCTAATCC
259 1 cycle:
95 0C ------------ 3 min.
5 μL PCR buffer 10X
2 mM Mgcl2
O145 F: CCATCAACAGATTTAGGAGTG
R: TTTCTACCGCGAATCTATC
609 30 cycle:
95 0C ------------ 20 s
58 0C ------------ 40 s
72 0C ------------ 30 s
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
O103 F: TTGGAGCGTTAACTGGACCT
R: GCTCCCGAGCACGTATAAG
321
O26 F: CAGAATGGTTATGCTACTGT
R: CTTACATTTGTTTTCGGCATC
423
O111 F: TAGAGAAATTATCAAGTTAGTTCC
R: ATAGTTATGAACATCTTGTTTAGC
406 1 cycle:
72 0C ------------ 8 min
3 μL DNA template
O91 F: GCTGACCTTCATGATCTGTTGA
R: TAATTTAACCCGTAGAATCGCTGC
291 1 cycle:
94 0C ------------ 6 min.
34 cycle:
95 0C ------------ 50 s
58 0C ------------ 70 s
72 0C ------------ 55 s
1 cycle:
72 0C ------------ 10 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
O128 F: GCTTTCTGCCGATATTTGGC
R: CCGACGGACTGATGCCGGTGATT
289
O121 F: TGGCTAGTGGCATTCTGATG
R: TGATACTTTAGCCGCCCTTG
322
O113 F: GGGTTAGATGGAGCGCTATTGAGA
R: AGGTCACCCTCTGAATTATGGCAG
771
O45 F: CCGGGTTTCGATTTGTGAAGGTTG
R: CACAACAGCCACTACTAGGCAGAA
527
stx1 F: AAATCGCCATTCGTTGACTACTTCT
R: TGCCATTCTGGCAACTCGCGATGCA
366 1 cycle:
95 0C ------------ 3 min.
34 cycle:
94 0C ------------ 60 s
56 0C ------------ 45 s
72 0C ------------ 60 s
1 cycle:
72 0C ------------ 10 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
stx2 F: CGATCGTCACTCACTGGTTTCATCA
R: GGATATTCTCCCCACTCTGACACC
282
eaeA F: TGCGGCACAACAGGCGGCGA
R: CGGTCGCCGCACCAGGATTC
629
ehly F: CAATGCAGATGCAGATACCG
R: CAGAGATGTCGTTGCAGCAG
432
aadA1 F: TATCCAGCTAAGCGCGAACT
R: ATTTGCCGACTACCTTGGTC
447 1 cycle:
94 0C ------------ 8 min.
32 cycle:
95 0C ------------ 60 s
55 0C ------------ 70 s
72 0C ------------ 2 min
1 cycle:
72 0C ------------ 8 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
tetA F: GGTTCACTCGAACGACGTCA
R: CTGTCCGACAAGTTGCATGA
577
tetB F: CCTCAGCTTCTCAACGCGTG
R: GCACCTTGCTGATGACTCTT
634
dfrA1 F: GGAGTGCCAAAGGTGAACAGC
R: GAGGCGAAGTCTTGGGTAAAAAC
367
qnr F: GGGTATGGATATTATTGATAAAG
R: CTAATCCGGCAGCACTATTTA
670
aac(3)-IV F: CTTCAGGATGGCAAGTTGGT
R: TCATCTCGTTCTCCGCTCAT
286
sul1 F: TTCGGCATTCTGAATCTCAC
R: ATGATCTAACCCTCGGTCTC
822
blaSHV F: TCGCCTGTGTATTATCTCCC
R: CGCAGATAAATCACCACAATG
768
CITM F: TGGCCAGAACTGACAGGCAAA
R: TTTCTCCTGAACGTGGCTGGC
462
cat1 F: AGTTGCTCAATGTACCTATAACC
R: TTGTAATTCATTAAGCATTCTGCC
547
cmlA F: CCGCCACGGTGTTGTTGTTATC
R: CACCTTGCCTGCCCATCATTAG
698