Skip to main content

Table 1 Oligonucleotide primers and PCR conditions used for amplification of the antibiotic resistance genes and virulence factors in the A. baumannii strains of animal origin [19, 34,35,36,37,38,39,40,41,42,43,44,45,46]

From: Genotyping and distribution of putative virulence factors and antibiotic resistance genes of Acinetobacter baumannii strains isolated from raw meat

Target gene Primer Sequence (5′-3′) Size of product (bp) PCR conditions Volume (50 μl)
draBC GCTGGGCAGCAAACTGATAACTCTC
CATCAAGCTGTTTGTTCGTCCGCCG
750 1 cycle:
95 0C ------------ 4 min.
30 cycle:
95 0C ------------ 50 s
58 0C ------------ 60 s
72 0C ------------ 45 s
1 cycle:
72 0C ------------ 8 min
5 μL PCR buffer 10X
1.5 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.25 U Taq DNA polymerase (Fermentas)
2.5 μL DNA template
cnf1 AAGATGGAGTTTCCTATGCAGGAG
CATTCAGAGTCCTGCCCTCATTATT
498
csgA ACTCTGACTTGACTATTACC
AGATGCAGTCTGGTCAAC
200
cvaC CACACACAAACGGGAGCTGTT
CTTCCCGCAGCATAGTTCCAT
680
iutA GGCTGGACATCATGGGAACTGG
CGTCGGGAACGGGTAGAATCG
300
fyuA TGATTAACCCCGCGACGGGAA
CGCAGTAGGCACGATGTTGTA
880
cnf2 AATCTAATTAAAGAGAAC
CATGCTTTGTATATCTA
543 1 cycle:
94 0C ------------ 6 min.
34 cycle:
95 0C ------------ 50 s
58 0C ------------ 70 s
72 0C ------------ 55 s
1 cycle:
72 0C ------------ 10 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
kpsMT II GCGCATTTGCTGATACTGTTG
CATCCAGACGATAAGCATGAGCA
272
PAI GGACATCCTGTTACAGCGCGCA
TCGCCACCAATCACAGCCGAAC
930
papC GACGGCTGTACTGCAGGGTGTGGCG
ATATCCTTTCTGCAGGGATGCAATA
328
fimH TGCAGAACGGATAAGCCGTGG
GCAGTCACCTGCCCTCCGGTA
508 1 cycle:
95 0C ------------ 4 min.
34 cycle:
94 0C ------------ 60 s
56 0C ------------ 45 s
72 0C ------------ 60 s
1 cycle:
72 0C ------------ 10 min
5 μL PCR buffer 10X
2 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
5 μL DNA template
ibeA AGGCAGGTGTGCGCCGCGTAC
TGGTGCTCCGGCAAACCATGC
170
PapG II-III CTGTAATTACGGAAGTGATTTCTG
ACTATCCGGCTCCGGATAAACCAT
1070
sfa/focDE CTCCGGAGAACTGGGTGCATCTTAC
CGGAGGAGTAATTACAAACCTGGCA
410
traT GGTGTGGTGCGATGAGCACAG
CACGGTTCAGCCATCCCTGAG
290
aadA1 TATCCAGCTAAGCGCGAACT
ATTTGCCGACTACCTTGGTC
447 1 cycle:
94 0C ------------ 6 min.
33 cycle:
95 0C ------------ 70 s
55 0C ------------ 65 s
72 0C ------------ 90 s
1 cycle:
72 0C ------------ 8 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0. 5 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
2 μL DNA template
aac(3)-IV CTTCAGGATGGCAAGTTGGT
TCATCTCGTTCTCCGCTCAT
286
sul1 TTCGGCATTCTGAATCTCAC
ATGATCTAACCCTCGGTCTC
822
blaSHV TCGCCTGTGTATTATCTCCC
CGCAGATAAATCACCACAATG
768
CITM TGGCCAGAACTGACAGGCAAA
TTTCTCCTGAACGTGGCTGGC
462
cat1 AGTTGCTCAATGTACCTATAACC
TTGTAATTCATTAAGCATTCTGCC
547
cmlA CCGCCACGGTGTTGTTGTTATC
CACCTTGCCTGCCCATCATTAG
698
tet(A) GGTTCACTCGAACGACGTCA
CTGTCCGACAAGTTGCATGA
577
tet(B) CCTCAGCTTCTCAACGCGTG
GCACCTTGCTGATGACTCTT
634
dfrA1 GGAGTGCCAAAGGTGAACAGC
GAGGCGAAGTCTTGGGTAAAAAC
367
qnr GGGTATGGATATTATTGATAAAG
CTAATCCGGCAGCACTATTTA
670
imp GAATAGAATGGTTAACTCTC
CCAAACCACTAGGTTATC
188 1 cycle:
95 0C ------------ 4 min.
30 cycle:
95 0C ------------ 45 s
58 0C ------------ 60s
72 0C ------------ 40 s
1 cycle:
72 0C ------------ 5 min
5 μL PCR buffer 10X
1.5 mM Mgcl2
100 μM dNTP (Fermentas)
1 μM of each primers F & R
1 U Taq DNA polymerase (Fermentas)
2.5 μL DNA template
vim GTTTGGTCGCATATCGCAAC
AATGCGCAGCACCAGGATAG
382
sim GTACAAGGGATTCGGCATCG
GTACAAGGGATTCGGCATCG
569
Oxa-23-like GATCGGATTGGAGAACCAGA
ATTTCTGACCGCATTTCCAT
501 1 cycle:
94 0C ------------ 5 min.
32 cycle:
95 0C ------------ 50 s
60 0C ------------ 60 s
72 0C ------------ 70 s
1 cycle:
72 0C ------------ 10 min
5 μL PCR buffer 10X
2.5 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
2 μL DNA template
Oxa-24-like GGTTAGTTGGCCCCCTTAAA
AGTTGAGCGAAAAGGGGATT
246
Oxa-51-like TAATGCTTTGATCGGCCTTG
TGGATTGCACTTCATCTTGG
353
Oxa-58-like AAGTATTGGGGCTTGTGCTG
CCCCTCTGCGCTCTACATAC
599