Skip to main content

Table 1 Set of primers and PCR circumstances applied for genotyping of vacA, cagA, iceA, oipA and babA alleles

From: Phenotypic analysis of antibiotic resistance and genotypic study of the vacA, cagA, iceA, oipA and babA genotypes of the Helicobacter pylori strains isolated from raw milk

Genes Primer Sequence (5′-3′) Size of product (bp) Volume of PCR reaction (50 μl) PCR programs
VacA s 1 a F: CTCTCGCTTTAGTAGGAGC
R: CTGCTTGAATGCGCCAAAC
213 5 μL PCR buffer 10 x 1.5 mM Mgcl2
200 μM dNTP (Thermo Fisher Scientific, St. Leon-Rot, Germany)
0.5 μM of each primers F & R
1.25 U Taq DNA polymerase (Thermo Fisher Scientific, St. Leon-Rot, Germany)
2.5 μL DNA template
1 cycle:
95 °C ------------ 1 min.
32 cycle:
95 °C ------------ 45 s
64 °C ------------ 50 s
72 °C ------------ 70 s
1 cycle:
72 °C ------------ 5 min
VacA s 1 b F: AGCGCCATACCGCAAGAG
CTGCTTGAATGCGCCAAAC
187
VacA s 1 c F: CTCTCGCTTTAGTGGGGYT
R: CTGCTTGAATGCGCCAAAC
213
VacA s 2 F: GCTAACACGCCAAATGATCC
R: CTGCTTGAATGCGCCAAAC
199
VacA m 1 a F: GGTCAAAATGCGGTCATGG
R: CCATTGGTACCTGTAGAAAC
290
VacA m 1 b F: GGCCCCAATGCAGTCATGGA
R: GCTGTTAGTGCCTAAAGAAGCAT
291
VacA m 2 F: GGAGCCCCAGGAAACATTG
R: CATAACTAGCGCCTTGCA
352
Cag A F: GATAACAGCCAAGCTTTTGAGG
R: CTGCAAAAGATTGTTTGGCAGA
300 5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Thermo Fisher Scientific, St. Leon-Rot, Germany)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Thermo Fisher Scientific, St. Leon-Rot, Germany)
3 μL DNA template
1 cycle:
94 °C ------------ 1 min.
32 cycle:
95 °C ------------ 60 s
56 °C ------------ 60 s
72 °C ------------ 60 s
1 cycle:
72 °C ------------ 10 min
IceA IceA1 F: GTGTTTTTAACCAAAGTATC
R: CTATAGCCASTYTCTTTGCA
247 5 μL PCR buffer 10 x 2 mM Mgcl2
150 μM dNTP (Thermo Fisher Scientific, St. Leon-Rot, Germany)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Thermo Fisher Scientific, St. Leon-Rot, Germany)
3 μL DNA template
1 cycle:
94 °C ------------ 1 min.
32 cycle:
94 °C ------------ 60 s
56 °C ------------ 60 s
72 °C ------------ 60 s
1 cycle:
72 °C ------------ 10 min
IceA2 F: GTTGGGTATATCACAATTTAT
R: TTRCCCTATTTTCTAGTAGGT
229/334
OipA F: GTTTTTGATGCATGGGATTT
R: GTGCATCTCTTATGGCTTT
401 5 μL PCR buffer 10 x 2 mM Mgcl2
150 μM dNTP (Thermo Fisher Scientific, St. Leon-Rot, Germany)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Thermo Fisher Scientific, St. Leon-Rot, Germany)
3 μL DNA template
1 cycle:
94 °C ------------ 1 min.
32 cycle:
94 °C ------------ 60 s
56 °C ------------ 60 s
72 °C ------------ 60 s
1 cycle:
72 °C ------------ 10 min
BabA F: CCAAACGAAACAAAAAGCGT
R: GCTTGTGTAAAAGCCGTCGT
105–124 5 μL PCR buffer 10 x 2 mM Mgcl2
150 μM dNTP (Thermo Fisher Scientific, St. Leon-Rot, Germany)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Thermo Fisher Scientific, St. Leon-Rot, Germany)
3 μL DNA template
1 cycle:
94 °C ------------ 1 min.
35 cycle:
94 °C ------------ 60 s
57 °C ------------ 45 s
72 °C ------------ 30 s
1 cycle:
72 °C ------------ 10 min