Skip to main content

Table 1 Primers and cycling conditions for the PCR assays

From: Antibiotic resistance, virulence factors and genotyping of Uropathogenic Escherichia coli strains

Gene Primer sequence Size (bp) Cycling condition Reference
hlyA F: AACAAGGATAAGCACTGTTCTGGCT
R: ACCATATAAGCGGTCATTCCCGTCA
1177 1 cycle of 95 °C for 5 min;30 cycles of 94 °C for 1 min, 64 °C for 1 min, 72 °C for 1 min; 72 °C for 8 min final extension [58]
FimH F:GAGAAGAGGTTTGATTTAACTTATTG
R: AGAGCCGCTGTAGAACTGAGG
559 1 cycle of 95 °C for 5 min;30 cycles of 94 °C for 1 min, 60 °C for 1 min, 72 °C for 1 min; 72 °C for 8 min final extension [60]
aer F: GCTGGGCAGCAAACTGATAACTCTC
R: CATCAAGCTGTTTGTTCGTCCGCCG
602 1 cycle of 95 °C for 5 min;30 cycles of 94 °C for 1 min, 62 °C for 1 min, 72 °C for 1 min; 72 °C for 8 min final extension [58]