Skip to main content

Table 1 Target genes, oligonucleotide primers and PCR conditions used for detection of antibiotic resistance genes in the MRSA strains isolated from hospital cockroaches (16–22)

From: Phenotypic and genotypic characterization of antibiotic resistance in the methicillin-resistant Staphylococcus aureus strains isolated from hospital cockroaches

Target gene Primer sequence (5′-3′) PCR product (bp) PCR programs PCR volume (50 μL)
AacA-D F: TAATCCAAGAGCAATAAGGGC
R: GCCACACTATCATAACCACTA
227 1 cycle:
94 0C ------------ 5 min.
25 cycle:
94 0C ------------ 60 s
55 0C ------------ 70 s
72 0C ------------ 60 s
1 cycle:
72 0C ------------ 10 min
5 μL PCR buffer 10X
1.5 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.25 U Taq DNA polymerase (Fermentas)
2.5 μL DNA template
ermA F: AAGCGGTAAACCCCTCTGA
R: TTCGCAAATCCCTTCTCAAC
190
tetK F: GTAGCGACAATAGGTAATAGT
R: GTAGTGACAATAAACCTCCTA
360
tetM F: AGTGGAGCGATTACAGAA
R: CATATGTCCTGGCGTGTCTA
158 1 cycle:
94 0C ------------ 6 min.
34 cycle:
95 0C ------------ 50 s
55 0C ------------ 70 s
72 0C ------------ 60 s
1 cycle:
72 0C ------------ 8 min
5 μL PCR buffer 10X
2 mM Mgcl2
200 μM dNTP (Fermentas)
0.5 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
5 μL DNA template
vatA F: TGGTCCCGGAACAACATTTAT
R: TCCACCGACAATAGAATAGGG
268
msrA F: GGCACAATAAGAGTGTTTAAAGG
R: AAGTTATATCATGAATAGATTGTCCTGTT
940 1 cycle:
94 0C ------------ 6 min.
34 cycle:
95 0C ------------ 60 s
50 0C ------------ 70 s
72 0C ------------ 70 s
1 cycle:
72 0C ------------ 8 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
vatB F: GCTGCGAATTCAGTTGTTACA
R: CTGACCAATCCCACCATTTTA
136 1 cycle:
94 0C ------------ 6 min.
35 cycle:
95 0C ------------ 50 s
55 0C ------------ 70 s
72 0C ------------ 80 s
1 cycle:
72 0C ------------ 10 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
linA F: GGTGGCTGGGGGGTAGATGTATTAACTGG
R: GCTTCTTTTGAAATACATGGTATTTTTCGA
323 1 cycle:
94 0C ------------ 6 min.
30 cycle:
95 0C ------------ 60 s
57 0C ------------ 60 s
72 0C ------------ 60 s
1 cycle:
72 0C ------------ 10 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
blaZ F: ACTTCAACACCTGCTGCTTTC
R: TGACCACTTTTATCA CAACC
490 1 cycle:
94 0C ------------ 5 min.
30 cycle:
94 0C ------------ 20 s
60 0C ------------ 30 s
72 0C ------------ 90 s
1 cycle:
72 0C ------------ 5 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
cat1 F: AGTTGCTCAATGTACCTATAACC
R: TTGTAATTCATTAAGCATTCTGCC
547 1 cycle:
94 0C ------------ 8 min.
32 cycle:
95 0C ------------ 60 s
55 0C ------------ 70 s
72 0C ------------ 2 min
1 cycle:
72 0C ------------ 8 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
gyrA F: AATGAACAAGGTATGACACC
R: TACGCGCTTCAGTATAACGC
223 1 cycle:
94 0C ------------ 10 min.
25 cycle:
94 0C ------------ 20 s
52 0C ------------ 20 s
72 0C ------------ 50 s
1 cycle:
72 0C ------------ 5 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
grlA F: ACTTGAAGATGTTTTAGGTGAT
R: TTAGG AAATCTTGATGGCAA
459
dfrA F: CTCACGATAAACAAAGAGTCA
R: CAATCATTGCTTCGTATAACG
201 1 cycle:
94 0C ------------ 2 min.
30 cycle:
94 0C ------------ 60 s
50 0C ------------ 60 s
72 0C ------------ 60 s
1 cycle:
72 0C ------------ 5 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template
rpoB F: ACCGTCGTTTACGTTCTGTA
R: TCAGTGATAGCATGTGTATC
460 1 cycle:
94 0C ------------ 5 min.
32 cycle:
94 0C ------------ 60 s
56 0C ------------ 45 s
72 0C ------------ 60 s
1 cycle:
72 0C ------------ 10 min
5 μL PCR buffer 10X
2 mM Mgcl2
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R
1.5 U Taq DNA polymerase (Fermentas)
3 μL DNA template