Skip to main content

Table 1 PCR primers used in this study

From: New genetic context of lnu(B) composed of two multi-resistance gene clusters in clinical Streptococcus agalactiae ST-19 strains

Primer Sequence (5′–3′) Product size (bp)
lnuB-F ACCAAAGGAGAAGGTGACCAA 584
lnuB-R ACCTTATCTAATCGAGCAGTGGT
3-F TTCGATTCCTCGTGCCTGAC 1877
3-R AAGCGAGGTCGTAACTGGTG
Rev-1-F ACGCCCTGTAACGCTTGTAA 2571
Rev-1-R TGCAAAGACCACTGCTCGAT
Rev-2-F GGTGAACGAAAGCCCACCTA