Skip to main content

Table 2 Oligonucleotide primers sequence and amplicon size

From: Phenotypic and genotypic characterization of carbapenem-resistant Acinetobacter baumannii isolates from Egypt

Primer name Nucleotide sequence (5′ → 3′) No. of bases Size of the amplicons (bps)
OXA-51-F [41] TAATGCTTTGATCGGCCTTG 20 353
OXA-51-R [41] TGGATTGCACTTCATCTTGG 20
OXA-23-F [41] GATCGGATTGGAGAACCAGA 20 501
OXA-23-R [41] ATTCTTGACCGCATTTCCAT 20
OXA-40-F [41] GGTTGTTGGCCCCCTTAAA 19 246
OXA-40-R [41] AGTTGAGCGAAAAGGGGATT 20
OXA-58-F [41] AAGTATTGGGGCTTGTGCTG 20 599
OXA-58-R [41] CCCCTCTGCGCTCTACATAC 20
ISAba1-F [17] GTGCTTTGCGCTCATCATGC 20 430
ISAba1-R [17] CATGTAAACCAATGCTCACC 20
ISAba2-F [17] AATCCGAGATAGAGCGGTTC 20 1100
ISAba2-R [17] TGACACATAACCTAGTGCAC 20
ISAba3-F [17] CAATCAAATGTCCAACCTGC 20 403
ISAba3-R [17] CGTTTACCCCAAACATAAGC 20
Pre NDM-F [42] CACCTCATGTTTGAATTCGCC 21 984
Pre NDM-R [42] CTCTGTCACATCGAAATCGC 20
Imp-F [43] GGAATAGAGTGGCTTAAYTCTC 22 188
Imp-R [43] CCAAACYACTASGTTATCT 19
Vim-F [43] GATGGTGTTTGGTCGCATA 19 390
Vim-R [43] CGAATGCGCAGCACCAG 17
Gim-F [43] TCGACACACCTTGGTCTGAA 20 477
Gim-R [43] AACTTCCAACTTTGCCATGC 20
Spm-F [43] AAAATCTGGGTACGCAAACG 20 271
Spm-R [43] ACATTATCCGCTGGAACAGG 20
Sim-F [43] TACAAGGGATTCGGCATCG 19 570
Sim-R [43] TAATGGCCTGTTCCCATGTG 20
KPC-F [44] GTATCGCCGTCTAGTTCTGC 20 637
KPC-R [44] GGTCGTGTTTCCCTTTAGCC 20