Skip to main content

Table 1 Sequences of primers and probes used in this study

From: The anti-virulence effect of cranberry active compound proanthocyanins (PACs) on expression of genes in the third-generation cephalosporin-resistant Escherichia coli CTX-M-15 associated with urinary tract infection

 ForwardReverseProbeAmplicon size (bp)Reference
16 sGGAGACTGCCAGTGATAAAGAGGTCGCTTCTCTTTGTCCTTACGACCAGGGCTACACACGT113This study
kpsMGTTATATGGGACCGTCATATTGCCACACTCTTTCGTATCCCCAGAGCTTGCGGATTATCAATC125This study
chuACGATGGGCGAAATGTATAAGTTAGTTTCCGGACGTAAGTCTCGATTGGTCGCTTCTATACCA98This study
CTX-MGAAAGCGAACCGAATCTGACATCGTCCCATTGACACCTTGTTAACTATAATCCGATTGCGG101This study
satAGAAATATGGCATCTGTCACCCAGACGATATAGTCGGTGTTTCCAGCAACCATTACTCTGGGACAGC97This study
uspTGAGTTCTGGTATGAGGAAGACCCGTATGAACACCATACACTACTGCCTGCTAGTGCTTTCTGCC126This study
soxSAGGGTTGATTACCAGTATCCAACATATCGCAACACATCACACAGCGGCAATCAGCGGCGATATA70This study
recAGAGACAATTTGGTACTCCATCGATATCCAGTGAAAGCGAACCGCCTGGGTGAAGACCGTTCCAT90This study
traTAGATTGCAGAGCGTACTAAGACACGGGTCTGGTATTTATGCAACGGATAATGTTGCCGCCCTGC127This study
ihfBGACGGTTGAAGATGCAGTAACGGTAGTGCAAAGAGAAACTAGCATATGGCCTCGACTCTTGCGC108This study
hcaTGGCATTATGGGAGCAACTACCTGGCGAGCAGCAATATAACACCACTATCAACCACGGCAACGCC114This study
  1. Primer and probe sets were designed using the PrimerQuest Tool (Integrated DNA Technologies). All probes contained a FAM fluorophore at the 5′ end and a black hole quencher at the 3′ end.