Skip to main content

Table 1 Principal oligonucleotide primers used in this study

From: Emerging coexistence of three PMQR genes on a multiple resistance plasmid with a new surrounding genetic structure of qnrS2 in E. coli in China

PrimerPrimer sequence (5′ → 3′)Amplicon size (bp)Parameters of PCR
P1TGCTGTGCTCGTCTAAT3531(95 °C, 5 min) + {(95 °C, 30 s) + (60 °C, 30 s) + (72 °C, 3 min 35 s)} × 34 + (72 °C, 5 min)
P2AATGCCTGGCGTGTTT
P3TGGCTATCACAACAAGG1190(95 °C, 5 min) + {(95 °C, 30 s) + (60.5 °C, 30 s) + (72 °C, 1 min 15 s)} × 29 + (72 °C, 5 min)
P4TTAGAACTAGGGCAGGA
P5CGCTTAACTAAGTGCAAGAA1008(95 °C, 5 min) + {(95 °C, 30 s) + (61.2 °C, 30 s) + (72 °C, 1 min 5 s)} × 29 + (72 °C, 5 min)
P6GCTACGCTGAGAACCATC