Skip to main content

Table 1 The primers used in the present study

From: The rapid and visual detection of methicillin-susceptible and methicillin-resistant Staphylococcus aureus using multiplex loop-mediated isothermal amplification linked to a nanoparticle-based lateral flow biosensor

Primer name Sequence and modifications Length Gene
F3 5′-GTCCTGAAAATAAAAAAGCACAT-3′ 23 nt femA
B3 5′-ACTTCCGGCAAAATGACG-3′ 18 nt  
FIP 5′-TGTTCTTCTTGTAGACGTTTACCTT-CGAGATAACTTACAACAACAACTTG-3′ 50 mer  
FIP* 5′-Dig- TGTTCTTCTTGTAGACGTTTACCTT-CGAGATAACTTACAACAACAACTTG −3′ 50 mer  
BIP 5′-ACCTATCTCTGCTGGTTTCTTCT-AATGCATTTGATGTACCACC-3′ 43 nt  
LF 5′-TCAATCTTTTGCTCATTTGC-3′ 20 nt  
LF* 5′-Biotin-TCAATCTTTTGCTCATTTGC-3′ 20 nt  
LB 5′-CCATTTGAAGTTGTTTATTATGC-3′ 23 nt  
F3 5′-GGCTCAGGTACTGCTATC-3′ 18 nt mecA
B3 5′-TTGTTATTTAACCCAATCATTGC-3′ 23 nt  
FIP 5′-ATGCCATACATAAATGGATAGACGT-CAAACAGGTGAATTATTAGCACTT-3′ 49 nt  
FIP* 5′-FAM-ATGCCATACATAAATGGATAGACGT-CAAACAGGTGAATTATTAGCACTT-3′ 49 nt  
BIP 5′-CCGAAGATAAAAAAGAACCTCTGCT-TTTTTGAGTTGAACCTGGTG-3′ 45 nt  
LF 5′-CATATGAAGGTGTGCTTAC-3′ 19 nt  
LF* 5′-Biotin-CATATGAAGGTGTGCTTAC-3′ 19 nt  
LB 5′-CAAGTTCCAGATTACAACTT-3′ 20 nt  
  1. Note: femA-FIP*, 5′-labeled with Dig when used in LAMP-LFB assay; femA-LF*, 5′-labeled with biotin when used in LAMP-LFB assay
  2. mecA-FIP*, 5′-labeled with FAM when used in the LAMP-LFB assay; mecA-LF*, 5′-labeled with biotin when used in the LAMP-LFB assay;
  3. Abbreviations: Dig digoxigenin, FAM carboxyfluorescein, nt nucleotide, mer monomeric unit