Skip to main content

Table 1 The primers of genes used in this study

From: Molecular analysis of methicillin-resistant Staphylococcus aureus isolates from four teaching hospitals in Iran: the emergence of novel MRSA clones

Target Gene Primer sequence (5′-3′) Size of product (bp) Reference
femA femA F: TGCTATCCACCCTCAAACAGG
R: AACGTTGTAACCACCCCAAGA
450 [13]
mecA mecA F: TGCTATCCACCCTCAAACAGG
R: AACGTTGTAACCACCCCAAGA
286 [17]
SCCmec ccrA2 F: TAAAGGCATCAATGCACAAACACT
R: AGCTCAAAAGCAAGCAATAGAAT
937 [18]
ccrC F: CCTTTATAGACTGGATTATTCAAAATAT
R:CGTCTATTACAAGATGTTAAGGATAAT
518  
IS1272 F: GCCACTCATAACATATGGAA
R: CATCCGAGTGAAACCCAAA
415
mecA-IS431 F: TATACCAAACCCGACAACTAC
R: CGGCTACAGTGATAACATCC
359
MSCRAMMs genes bbp F: AACTACATCTAGTACTCAACAACAG
R: ATGTGCTTGAATAACACCATCATCT
575 [5]
cna F: GTCAAGCAGTTATTAACACCAGAC
R: AATCAGTAATTGCACTTTGTCCACTG
423
eno F: ACGTGCAGCAGCTGACT
R: CAACAGCATYCTTCAGTACCTTC
302
ebpS F: CATCCAGAACCAATCGAAGAC
R:CTTAACAGTTACATCATCATGTTTATCTTTG
186
fnbA F: GTGAAGTTTTAGAAGGTGGAAAGATTAG
R: GCTCTTGTAAGACCATTTTTCTTCAC
643
fnbB F: GTAACAGCTAATGGTCGAATTGATACT
R: CAAGTTCGATAGGAGTACTATGTTC
524
fib F: CTACAACTACAATTGCCGTCAACAG
R: GCTCTTGTAAGACCATTTTCTTCAC
404
clfA F: ATTGGCGTGGCTTCAGTGCT
R: CGTTTCTTCCGTAGTTGCATTTG
292
Housekeeping genes arc up: TTGATTCACCAGCGCGTATTGTC
dn: AGGTATCTGCTTCAATCAGCG
456 www.pubmlst.com
aro up: ATCGGAAATCCTATTTCACATTC
dn: GGTGTTGTATTAATAACGATATC
456
glp up: CTAGGAACTGCAATCTTAATCC
dn: TGGTAAAATCGCATGTCCAATTC
465
gmk up: ATCGTTTTATCGGGACCATC 429
dn: TCATTAACTACAACGTAATCGTA  
pta up: GTTAAAATCGTATTACCTGAAGG
dn: GACCCTTTTGTTGAAAAGCTTAA
474  
tpi up: TCGTTCATTCTGAACGTCGTGAA
dn: TTTGCACCTTCTAACAATTGTAC
402
ygi up: CAGCATACAGGACACCTATTGGC
dn: CGTTGAGGAATCGATACTGGAAC
516