Skip to main content

Table 1 PCR primers of fosA, fosB, fosC, murA, glpT, and uhpT genes

From: Prevalence of fosfomycin resistance and gene mutations in clinical isolates of methicillin-resistant Staphylococcus aureus

Primers Genes Primer sequences (5 > 3) Product size References
fosB-F fosB CAGAGATATTTTAGGGGCTGACA 312 bp [25]
fosB-R CTCAATCTATCTTCTAAACTTCCTG  
murA-F murA GCCCTTGAAAGAATGGTTCGT 1600 bpa NC_002745.2b
murA-R GTTACAATACTCGACGCAGGT
glpT-F glpT TGAATAAAACAGCAGGGCAA 1699 bpa NC_002745.2b
glpT-R CACAGCTAGTATGTATAACGAC
uhpT-F uhpT TGTGTTTATGTTCAGTATTTTGGA 1571 bpa NC_002745.2b
uhpT-R TCTTTCATCTCTTCACGCAC
  1. a PCR product including surrounding sequences adjacent to target gene
  2. b GenBank-EMBL-DDBL accession number