Skip to main content

Table 3 Primer sequences, genes for beta-lactamase and the expected amplicon sizes

From: Antibiogram and beta-lactamase genes among cefotaxime resistant E. coli from wastewater treatment plant

Group Gene name Primer sequence (5′–3′) Expected amplicon size (bp)
ESBLS genes blaTEM GTCGCCGCATACACTATTCTCA 258
CGCTCGTCGTTTGGTATGG
blaCTX-M CGGGAGGCAGACTGGGTGT 381
TCGGCTCGGTACGGTCGA
blaSHV GCCTTGACCGCTGGGAAAC 319
GGCGTATCCCGCAGATAAAT
Carbapenemase genes blaVIM GATGGTGTTTGGTCGCATA 390
CGAATGCGCAGC
blaOXA-1 TTCTGTTGTTTGGGTTTCGC 190
ACGCAGGAATTGAATTTGTTC
blaKPC-2 GCTTCCCACTGTGCAGCTCATTC 213
CGCCCAACTCCTCAGCAACAATTG
blaNDM-1 GGTGCATGCCCGGTGAAATC 660
ATGCTGGCCTTGGGGAACG