Skip to main content

Table 4 Primer sequences and expected amplicon sizes of the pathogenic Strains of E. coli (Pathotyping)

From: Antibiogram and beta-lactamase genes among cefotaxime resistant E. coli from wastewater treatment plant

Target strainGene TargetPrimer Sequence (5′–3′)Amplicon Size (bp)
EAECEaggAGA CTC TGG CGA AAG ACT GTA TC194
ATG GCT GTC TGT AAT AGA TGA GAA C
EPECEaeACTG AAC GGC GAT TAC GCG AA917
GAC GAT ACG ATC CAG
ETECLTGGC GAC AGA TTA TAC CGT GC450
CGG TCT CTA TAT TCC CTG TT
STATTTTTCTTTCTGTATTGTCTT190
CACCCGGTACAAGCAGGATT
EIECshigCTGGTAGGTATGGTGAGG320
CCAGGCCAACAATTATTTCC