Skip to main content

Table 4 Primer sequences and expected amplicon sizes of the pathogenic Strains of E. coli (Pathotyping)

From: Antibiogram and beta-lactamase genes among cefotaxime resistant E. coli from wastewater treatment plant

Target strain Gene Target Primer Sequence (5′–3′) Amplicon Size (bp)
EAEC Eagg AGA CTC TGG CGA AAG ACT GTA TC 194
ATG GCT GTC TGT AAT AGA TGA GAA C
EPEC EaeA CTG AAC GGC GAT TAC GCG AA 917
GAC GAT ACG ATC CAG
ETEC LT GGC GAC AGA TTA TAC CGT GC 450
CGG TCT CTA TAT TCC CTG TT
ST ATTTTTCTTTCTGTATTGTCTT 190
CACCCGGTACAAGCAGGATT
EIEC shig CTGGTAGGTATGGTGAGG 320
CCAGGCCAACAATTATTTCC