Skip to main content

Table 1 Genes and their primers sequences for molecular characterization of K. pneumoniae

From: Prevalence of pathogenic Klebsiella pneumoniae based on PCR capsular typing harbouring carbapenemases encoding genes in Uganda tertiary hospitals

Target genes Primer sequence Ampilicon size (Bp) References
khe F: TGATTGCATTCGCCACTGG
R: GGTCAACCCAACGATCCTG
428 Neuberger et al. [53]
WzyK1 F: GGTGCTCTTTACATCATTGC
R: GCAATGGCCATTTGCGTTAG
1283 Turton et al. [54]
WzyK2 F: GACCCGATATTCATACTTGACAGAG
R: CCTGAAGTAAAATCGTAAATAGATGGC
641 Turton et al. [54]
WzxK5 F: TGGTAGTGATGCTCGCGA
R: CCTGAACCCACCCCAATC
280 Turton et al. [54]
WzyK20 F: CGGTGCTACAGTGCATCATT
R: GTTATACGATGCTCAGTCGC
741 Fang et al. [9]
WzxK54 F: CATTAGCTCAGTGGTTGGCT
R: GCTTGACAAACACCATAGCAG
881 Fang et al. [9]
Wzy57 F: CTCAGGGCTAGAAGTGTCAT
R: CACTAACCCAGAAAGTCGAG
1037 Pan et al. [41]
WzyK3 F: TAGGCAATTGACTTTAGGTG
R: AGTGAATCAGCCTTCACCT
549 Fevre et al. [10]
BlaKPC F-ATG TCA CTG TAT CGC CGT CT
R-TTT TCA GAG CCT TAC TGC CC
538 Dallenne et al. [19]
BlaIMP-1 F-TGA GCA AGT TAT CTG TAT TC
R-TTA GTT GCT TGG TTT TGA TG
139 Dallenne et al. [19]
BlaIMP-2 F-GGC AGT CGC CCT AAA ACA AA
R-TAG TTA CTT GGC TGT GAT GG
139 Dallenne et al. [19]
BlaVIM F-GAT GGT GTT TGG TCG CAT A
R-CGA ATG CGC AGC ACC AG
390 Dallenne et al. [19]
BlaNDM F-GGT TTG GCG ATC TGG TTT TC
R-CGG AAT GGC TCA TCA CGA TC
521 Mushi  et al. [24]
BlaOXA-48 like F-TTG GTG GCA TCG ATT ATC GG
R- GAG CAC TTC TTT TGT GAT GGC
281 Dallenne et al. [19]