Skip to main content

Table 1 Primer sequences of each gene

From: Mechanical ventilation-associated pneumonia caused by Acinetobacter baumannii in Northeast China region: analysis of genotype and drug resistance of bacteria and patients’ clinical features over 7 years

Gene Sequence
IPM-F GTTACGGTGAAAATCCACACC
IPM-R AATGATTTCACGCACTCAAGG
VIM-F GCATTCGACCGACAACTTAGT
VIM-R TCCGGGTAGTGTTGTTGAATC
OXA23-F TCCCAGTCTATCAGGAACTTGC
OXA23-R GGCGTAACCTTTAATGGTCCTA
OXA24-F AGACGGACTGGCCTAGAGCTA
OXA24-R ATCGGTTATGTGCAAGGTCATC
OXA51-F TCCAACAAGGCCAAACTCAAC
OXA51-R CTTCTGTGGTGGTTGCCTTATG
OXA58-F CAAATAGGCACGGAAGTTGAT
OXA58-R CACTTGTTGCTGAACTTCAGGT
AdeA-F CAATATCGTCAGGCTCTAGCC
AdeA-R GACCAATGCACCTTCAGTGAC
AdeB-F GTAACGCCACAATGGAATAAGG
AdeB-R AATCAGTTGTTCCATTTCACGC
AdeC-F TGCAGTTTCAGGATTAGACCTT
AdeC-R TACTGGCTCATGCAATAACACA
AdeF-F ATATGGGACTTGCCAATGAAAC
AdeF-R ATTCGTGCATATAGGCCTGGTA
AdeG-F TAACTCGCTTACCCTATCTCCTG
AdeG-R CTTTACCATAGTTGTCTGACGCA
AdeH-F TATTAGGAAAACCACCAGCAGAC
AdeH-R ATATCGGGTCGTCTTTCAAGTAA
16 s rRNA-F GTAGCTTGCTACTGGACCTAG
16 s rRNA-R CATACTCTAGCTCACCAGTATCG