Skip to main content

Table 1 Oligonucleotide sequences of the primer pairs used for molecular resistance gene detection

From: Prevalence and characterization of antimicrobial resistance among gram-negative bacteria isolated from febrile hospitalized patients in central Ethiopia

Primer Sequence (5′–3′) Amplicon size (bp) References
blaSHV (F) AGCCGCTTGAGCAAATTAAAC 786 [12]
blaSHV (R) GTTGCCAGTGCTCGATCAGC
blaTEM (F) CATTTCCGTGTCGCCCTTATTC 846 [12]
blaTEM (R) CCAATGCTTAATCAGTGAGGC
blaCTX-M-1 (F) CGTCACGCTGTTGTTAGGAA 781 [12]
blaCTX-M-1 (R) ACGGCTTTCTGCCTTAGGTT
blaCTX-M-2 (F) CTCAGAGCATTCGCCGCTCA 843 [12]
blaCTX-M-2 (R) CCGCCGCAGCCAGAATATCC
blaCTX-M-9 (F) GCGCATGGTGACAAAGAGAGTGCAA 876 [12]
blaCTX-M-9 (R) GTTACAGCCCTTCGGCGATGATTC
blaNDM-1 (F) CGG CAT CACCGA GAT TGC 732 [13]
blaNDM-1 (R) CACCGA CAT CGC TTTTGGT
blaOXA-51 (F) TGT CTAAGGAAGTGAAGCGTG 112 [14]
blaOXA-51 (R) AACTGTGCCTCTTGCTGAG
  1. F forward, R reverse, bp base pairs