Skip to main content

Table 1 Sequences of primers used in this study

From: Synergistic effect of eugenol with Colistin against clinical isolated Colistin-resistant Escherichia coli strains

Primer name Sequence(5′-3′) Product size(bp)
mcr-1-F TGCTCCAAAATGCCCTACAGACC 141
mcr-1-R TGCCCCAAGTCGGATAATCCAC  
16SrRNA-F TGTCGTCAGCTCGTGTTGTG 130
16SrRNA-R ATCCCCACCTTCCTCCAGTT