Skip to main content

Advertisement

Table 1 Oligonucleotide primers used in this study

From: Prevalence of different carbapenemase genes among carbapenem-resistant Acinetobacter baumannii blood isolates in Taiwan

Primer Sequence (5′-3′) Reference
OXA-51-like forward TAA TGC TTT GAT CGG CCT TG 6
OXA-51-like reverse TGG ATT GCA CTT CAT CTT GG  
OXA-23-like forward GAT CGG ATT GGA GAA CCA GA 6
OXA-23-like reverse ATT TCT GAC CGC ATT TCC AT  
OXA-24-like forward GGT TAG TTG GCC CCC TTA AA 6
OXA-24-like reverse AGT TGA GCG AAA AGG GGA TT  
OXA-58-like forward AAG TAT TGG GGC TTG TGC TG 6
OXA-58-like reverse CCC CTC TGC GCT CTA CAT AC  
OXA-143-F TGGCACTTTCAGCAGTTCCT 7
OXA-143-R TAATCTTGAGGGGGCCAACC  
OXA-235-F TTGTTGCCTT TACTTAGTTGC 8
OXA-235-R CAAAATTTTAAGACGGAT CG  
Imp-F GGA ATA GAG TGG CTT AAY TCT C 9
Imp-R CCA AAC YAC TAS GTT ATC T  
Vim-F GAT GGT GTT TGG TCG CAT A 9
Vim-R CGA ATG CGC AGC ACC AG  
Sim-F TAC AAG GGA TTC GGC ATC G 9
Sim-R TAA TGG CCT GTT CCC ATG TG  
Gim-F TCG ACA CAC CTT GGT CTG AA 9
Gim-R AAC TTC CAA CTT TGC CAT GC  
Spm-F AAA ATC TGG GTA CGC AAA CG 9
Spm-R ACA TTA TCC GCT GGA ACA GG  
NDM-F GGTTTGGCGATCTGGTTTTC 10
NDM-R CGGAATGGCTCATCACGATC  
KPC-Fm CGTCTAGTTCTGCTGTCTTG 10
KPC-Rm CTTGTCATCCTTGTTAGGCG  
GES-C GTTTTGCAATGTGCTCAACG 11
GES-D TGCCATAGCAATAGGCGTAG