Skip to main content

Table 1 Single nucleotide variant (SNV) differences between outbreak strains

From: Investigation of a Carbapenemase-producing Acinetobacter baumannii outbreak using whole genome sequencing versus a standard epidemiologic investigation

   SNV Analysis
Year Identifier PFGE Pulsovar Pseudo-alignment Difference in SNVs from Index Case
2012 1 A5-c CGCAAGCTTCTGGTTTAACC Index case
2 A CACAAGACTCTGGTTCAACC 4
3 A5 CGCAAGACTCTGGTTTAACC 2
4 A4 CGCCAGCTTCTGATTTAACC 2
2013 5 A5 CGCAAGACTCTGGTTTAACC 2
6 A5 CGCAAGACTCCGGTTTAACC 3
7 A5 CGCAAGACTCCGGTTTAACC 3
8 A5 CGCAAGACTCCGGTGTAACC 4
9 A5 CGCAAGACTCCGGTTTAGCC 4
10 A5 CGCAAGACTCCGGTTTAACC 3
11 A5 CGCAAGACCCTAGTTTAACC 4
12 A5 CGCAAGACTCCGGTTTAACC 3
13 A4 CGCATAACTCCGGTTTAACC 5
14 A6 CGCAAAACTCCGGTTTAACC 4
15 A4 CGCATAACTCCGGTTTAACC 5
16 A6 CGCATAACTCCGGTTTAACC 5
17 A5 CGCAAGACTCTGGTTTAACC 2
18 A5 TGTAAGACTCTGGTTTAACC 4
19 A5-a CGCAAGACTCTGGTTTAACC 2
20 A5-a CGCAAGACTCTGGTTTAACC 2
21 A5-a CGCAAGACTCTGGTTTAACC 2
22 A5-a CGCAAGACTCTGGTTTAACC 2
23 A5-a CGCAAGACTCTGGTTTAACC 2
24 A5 TGTAAGACTCTGGTTTAACC 4
25 A5 CGCAAGACTCTGGTTTAATC 3
26 A5 TGTAAGACTCTGGTTTAACC 4
27 A5 TGTAAGACTCTGGTTTAACC 4
2014 28 A6 CGCAAGACTCTGGATTCACC 4
  1. Bolded letters represent a SNV difference compared to the index case
  2. Abbreviations: SNV, single nucleotide variants; PFGE, pulsed-field gel electrophoresis; Q, quarter