Skip to main content

Table 1 Primers used for PCR amplification of qnr and bla genes identification

From: Distribution of quinolone resistance gene (qnr) in ESBL-producing Escherichia coli and Klebsiella spp. in Lomé, Togo

Bla Genes Sequence (5′ – 3′) Size (pb) References
qnrA For: ATTTCTCACGCCAGGATTTG
Rev.: GATCGGCAAAGGTTAGGTCA
516 [21]
qnrB For: GATCGTGAAAGCCAGAAAGG
Rev.: ACGATGCCTGGTAGTTGTCC
469 [21]
qnrS For: ACGACATTCGTCAACTGCAA
Rev.: TAAATTGGCACCCTGTAGGC
417 [21]
TEM For: CATTTCCGTGTCGCCCTTATTC
Rev.: CGTTCATCCATAGTTGCCTGAC
800 [22]
SHV For: AGCCGCTTGAGCAAATTAAAC
Rev.: ATCCCGCAGATAAATCACCAC
713 [22]
CTX-M-G1 For: GTTACAATGTGTGAGAAGCAG
Rev.: CCGTTTCCGCTATTACAAAC
1000 [23]