Skip to main content

Table 1 PCR conditions and primer sequences

From: Prevalence and abundance of selected genes conferring macrolide resistance genes in COPD patients during maintenance treatment with azithromycin

Primer Sequence
5′ - 3’
Amplicon size (bp) Cycling conditions
16SrDNA_F CCTACGGGNGGCWGCAG 465 1 × 95 °C, 3’
16SrDNA_R GACTACHVGGGTATCTAATCC   35 × 95 °C, 15″; 55 °C, 20″; 72 °C, 30″
ermB_F AAGGGCATTTAACGACGAAACTG 438 1 × 95 °C 3’
ermB_R ATTTATCTGGAACATCTGTGGTATG   40 × 95 °C 15″, 60 °C 20″, 72 °C 30″
ermF_F CGACACAGCTTTGGTTGAAC 120 1 × 95 °C 3′
ermF_R TTTGACACCACTTTGAAAGGAAA   40 × 95 °C 15″, 58 °C 20″, 72 °C 30″
mefA CCTGCAAATGGCGATTATTT 199 1 × 95 °C 3′
mefA AATAGCAAGCACTGCACCAG   40 × 95 °C 15″, 58 °C 20″, 72 °C 30″