Skip to main content

Table 2 Primers used in the study

From: Fluoroquinolone resistance of Staphylococcus epidermidis isolated from healthy conjunctiva and analysis of their mutations in quinolone-resistance determining region

Target gene Primer sequence (5′ to 3′) Product size (bp)
gyrA (FOR) ATGCGTGAATCATTCTTAGACTATGC 284
gyrA (REV) GAGCCAAAGTTACCTTGACC
gyrB (FOR) CAGCATTAGACGTTTCAAG 251
gyrB (REV) CCAATACCCGTACCAAATGC
parC (FOR) TCGCAATGTATTCAAGTGGG 197
parC (REV) ATCGTTATCGATACTACCATT
parE (FOR) AAGCTCAACAAGCACGCGAGGCTG 324
parE (REV) TTAAAGTCAGTACCAACACCAGCAC
  1. Nucleotide positions are indicated according to GenBank sequence number NC 002976 (Staphylococcus epidermidis RP62A)