Skip to main content

Table 1 PCR primers of the current study

From: Prevalence and molecular characteristics of ESBL and AmpC β -lactamase producing Enterobacteriaceae strains isolated from UTIs in Egypt

Gene name Primer sequence fragment Size (bp) Annealing Temperature Reference
blaTEM AAACGCTGGTGAAAGTA
AGCGATCTGTCTAT
822 58 [21]
blaSHV ATGCGTTATATTCGCCTGTG
TGCTTTGTTATTCGGGCCAA
753 60 [21]
blaCTX-M-1 GGT TAA AAA ATC ACT GCG TC
TTG GTG ACG ATT TTA GCC GC
850 55 [22]
blaCTX-M - 9 ATG GTG ACA AAG AGA GTG CA
CCC TTC GGC GAT GAT TCT C
850 55 [22]
blaCTX-M- 2 F CGACGCTACCCCTGCTATT
R CCAGCGTCAGATTTTTCAGG
552 52 [23]
blaCTX-M − 8 TCGCGTTAAGCGGATGATGC
AACCCACGATGTGGGTAG
666 52 [23]
blaCTX-M-15 CACACGTGGAATTTAGGGACT
GCCGTCTAAGGCCATAAACA
996 55 [24]
MOX GCTGCTCAAGGAGCACAGGAT
CAC ATT GAC ATA GGT GTG GTG C
520 64 [25]
FOX AAC ATG GGG TAT CAG GGA GAT G
CAA AGC GCG TAA CCG GAT TGG
190
DHA AAC TTT CAC AGG TGT GCT GGG T
CCG TAC GCA TAC TGG CTT TGC
405
CIT TGG CCA GAA CTG ACA GGC AAA
TTT CTC CTG AAC GTG GCT GGC
462
aac(6_)-Ib F: TTGCGATGCTCTATGAGTGGCTA
R: CTCGAATGCCTGGCGTGTTT
482 55 [26]