Skip to main content

Table 1 Primers used in this study

From: Characteristics and diversity of mutations in regulatory genes of resistance-nodulation-cell division efflux pumps in association with drug-resistant clinical isolates of Acinetobacter baumannii

Target genes Primer sequence (5′–3′) Amplicon (bp) References
PCR and sequencing
OXA-51 F: TAATGCTTTGATCGGCCTTG
R: TGGATTGCACTTCATCTTGG
353 [23]
rpoB F: GTGATAARATGGCBGGTCGT
R: CGBGCRTGCATYTTGTCRT
543 [24]
adeB F: TTAACGATAGCGTTGTAACC
R: TGAGCAGACAATGGAATAGT
541 [30]
adeG F: TTCATCTAGCCAAGCAGAAG
R: ATGTGGGCTAGCTAACGGC
652 [9]
adeJ F: ATTGCACCACCAACCGTAAC
R: TAGCTGGATCAAGCCAGATA
463 [30]
adeR F: ATGAGTGTGTAGGGATAATC
R: TACTACAGAAAATAGCGTAAC
961 This study
adeSa F: ATGTTAATTAATGTGCGTGGC
R: CAGCTTATATGTTAGGTGTCC
1315 This study
adeS F: ATGAAAAGTAAGTTAGGAATTAGTAAG
R: TTAGTTATTCATAGAAATTTTTATG
1074 [15]
baeS1b F1: TAAAGATGAAGAAACAATGGAG
R1: ATCACCTAACTCATCATTTCG
1024 This study
baeS2b F2: CCAGTTTTAGATAAAGAAGATGC
R2: ACCAGATGCGCTAACTCGAC
1014 This study
baeR F: CATTAGGTGGTTTACGTTGTG
R: CTGATGTCGCGGTGAGCTG
845 This study
adeL F: TGGACGGAGCATAAAAGTTTG
R: CAATTTCTATACCATAAGTTAAGG
1246 This study
adeN F: AAACATACCAATGACCATCG
R: GTAGCTACTCCATAATAATTG
842 This study
RT-PCR analysis
adeB F: AACGGACGACCATCTTTGAGTATT
R: CAGTTGTTCCATTTCACGCATT
84 [15]
adeG F: AACTATGCGGTGCTCAAC
R: GGTGAATTACTTGGTGATGC
218 [5]
adeJ F: AGCTGGTGCTATGGGCGTTA
R: GCCACCCCATGCAATACG
64 [31]
rpoB F: GAGTCTAATGGCGGTGGTTC
R: ATTGCTTCATCTGCTGGTTG
110 [14]
  1. aPrimer sets designed in this study for adeS gene, but could not successfully amplify it
  2. bSince the complete sequence of the baeS gene is 1659 bp, we designed two overlapping primer pairs for full-length amplification and sequencing of this gene