Skip to content

Advertisement

  • Research
  • Open Access

High frequency and molecular epidemiology of metallo-β-lactamase-producing gram-negative bacilli in a tertiary care hospital in Lahore, Pakistan

  • 1,
  • 1,
  • 1,
  • 1,
  • 1,
  • 1,
  • 2 and
  • 1, 3Email author
Antimicrobial Resistance & Infection Control20187:128

https://doi.org/10.1186/s13756-018-0417-y

  • Received: 21 May 2018
  • Accepted: 5 October 2018
  • Published:

Abstract

Background

Metallo-β-lactamase (MBL)-producing isolates have a strong impact on diagnostic and therapeutic decisions. A high frequency of MBL-producing gram-negative bacilli has been reported worldwide. The current study was based on determining the incidence of MBL-producing imipenem-resistant clinical isolates and investigating the β-lactamase gene variants in strains conferring resistance to a carbapenem drug (imipenem).

Methods

A total of 924 gram negative isolates were recovered from a tertiary care hospital in Lahore, Pakistan, during a two-year period (July 2015 to February 2017). The initial selection of bacterial isolates was based on antibiotic susceptibility testing. Strains resistant to imipenem were processed for the molecular screening of β-lactamase genes. Statistical analysis for risk factor determination was based on age, gender, clinical specimen and type of infection.

Results

The rate of imipenem resistance was calculated to be 56.51%. Among the 142 strains processed, the phenotypic tests revealed that the incidence of MBLs was 63.38% and 86.61% based on the combination disc test and the modified Hodge test, respectively. The frequencies of blaTEM, blaSHV, blaOXA, blaIMP-1, and blaVIM genes were calculated to be 46%, 34%, 24%, 12.5% and 7%, respectively. The co-expression of blaMBL (blaIMP and blaVIM) and blaESBL (blaTEM, blaSHV, blaOXA) was also detected through multiplex and singleplex PCR. blaOXA, blaTEM and blaSHV coexisted in 82% of the isolates. Co-expression of ESBL and MBL genes was found in 7% of the isolates.

Conclusion

To our knowledge, this is the first report from Pakistan presenting the concomitant expression of blaOXA, blaTEM and blaSHV with blaIMP-1 and blaVIM in MBL-producing gram-negative bacilli.

Background

Dissemination of life-threatening infections caused by β-lactamase-producing pathogens is a major setback to antimicrobial therapy. The widespread use of carbapenems has resulted in the emergence of carbapenemases, conferring resistance against carbapenem drugs [13]. Resistance to carbapenems is worrisome because of the very limited therapeutic options available to treat resistant infections [4, 5]. The diverse mechanisms of resistance to imipenem include AmpC enzymes accompanied by membrane porin alterations and upregulation of efflux pumps [5, 6]. The second phenomenon is carbapenem hydrolysis by carbapenemases [79]. The epicentre for the emergence of carbapenemases and that of extended spectrum beta lactamases (ESBLs) were different, but the association of their genes is apparent through some studies, where ESBL genes are found to exist in MBL-producing isolates [10].

Among carbapenemases, metallo-β-lactamases (MBLs) are of prime importance for the region under study because of the emergence of new variants of MBL, such as New Delhi metallo-β-lactamase (NDM) [11] and various IMP variants from the subcontinent. MBLs belong to class B carbapenemases according to the Ambler classification system [12]. blaIMP, blaNDM and blaVIM are important MBL gene clusters that are carried by mobile plasmids compatible with a vast array of clinically important pathogens [13, 14]. In addition, oxacillinases belonging to class D include serine β-lactamases and are known to be associated primarily with Enterobacteriaceae carbapenem-resistant epidemics.

With more than 37 types of IMP carbapenemases known [15], IMP-1 was the first to be reported in Japan in 1991[16]. IMP-4-type enzymes, first discovered in Hong Kong during the 2000s [17], were later found to be responsible for an outbreak in 2005 in Melbourne, Australia [18]. The dissemination of resistance genes from Serratia spp. and Pseudomonas aeruginosa to other members of Enterobacteriaceae caused these genes to become endemic in Australia. Approximately 20 different subtypes of IMP enzymes have been described to be associated with Pseudomonas spp., Acinetobacter spp. and Enterobacteriaceae infections throughout the globe [19].

The first case of VIM-1 enzyme-conferred resistance was reported in 1999 in Verona, Italy [20]. With reports of VIM-2 being highly prevalent in Europe, Asia, America and Africa [21], a recent global surveillance study reported four new variants of VIM [22]. After their discovery in New Delhi in 2009 [23], NDM-1-producing Klebsiella pneumoniae and E. coli have been widely reported throughout the globe, including various European countries as well as China, Kenya, Japan, Algeria and Syria [2427]. A research study has indicated dissemination of the NDM-1 carbapenemase gene through horizontal gene transfer in Pakistan, India and the UK [28].

The rise in carbapenem resistance in Asian countries has been evident, as reported imipenem resistance rose from 20% in the Philippines [29] to 40% in Vietnam [30]. Recently, > 50% carbapenem-resistant Klebsiella pneumoniae isolates have been recorded in India [31]. With the first report of emergence among Acinetobacter baumannii clinical isolates in Scotland in 1985 [32], plasmid-borne OXA-48 carbapenemases were reported to be highly disseminated in isolates from 18 countries in Europe and Africa [33].

The resistance pattern of metallo-β-lactamases in Pakistan has not been widely studied. In Pakistan, imipenem was only rarely available prior to the year 2000 [34]. Later, carbapenem resistance was reported mainly in P. aeruginosa in Lahore and Karachi [35, 36]. A report from Rawalpindi confirmed that 78% of isolates were MBL producers, with major incidence of MBL production in Acinetobacter baumannii and Pseudomonas aeruginosa [37].

A very limited number of reports have been published from Pakistan that are based on molecular analysis of genes acquired by carbapenem-resistant isolates. This study aimed to determine the incidence of MBLs through phenotypic and genotypic analyses. Moreover, this study is based on the detection of the gene variants responsible for resistance to carbapenem drugs. To the best of our knowledge, this is the first study from Lahore on the molecular epidemiology and coexistence of blaESBLs and blaMBLs.

Methods

Study design

Microbiological testing was conducted at the pathology laboratory of Allama Iqbal Medical College Lahore from July 2015 to July 2017. The study was approved by the Ethical Committee of Citilab and Research Centre Pakistan (CitiLab and Research Centre Ref # 30th − 15 CLRC/ 30th). The segment of the work based on molecular analysis was carried out at the Department of Microbiology and Molecular Genetics, University of the Punjab, Lahore.

Bacterial isolates

A total of 3000 samples were obtained from clinical samples. All clinical specimens were subjected to isolation and identification of significant pathogens according to CLSI procedures (CLSI 2015, 2016). Among 2000 cultures with positive growth, 924 gram negative isolates bacilli were further screened for acquisition of imipenem resistance. On the basis of antibiotic susceptibility patterns, 142 isolates resistant to imipenem were further analysed by molecular tools. Identification of bacterial isolates was performed on the basis of culture characteristics, gram staining and conventional biochemical tests. Confirmation of gram-negative isolates was performed by API 20 NE identification strips (bioMerieux, France). The identified strains were stored in 30% glycerol broth at − 70 °C. Isolates were obtained from wound infections (n = 487), urine samples (n = 187), sputum samples (n = 90), tips and catheters (n = 47), fluids and effusions (n = 44) and others, including tissue samples, bone samples, and vaginal swabs (n = 57) (Table 3).

Antimicrobial susceptibility testing

Antimicrobial susceptibility testing (AST) for all isolates was carried out by the Kirby-Bauer method [38] on Mueller-Hinton agar plates (Oxoid) as per Clinical and Laboratory Standard Institute (CLSI, 2016) recommendations. The antibiotic panel used in screening of the cultures was specific for gram-negative bacteria: penicillins (amoxicillin 30 μg, amoxicillin-clavulanic acid 40 μg, and piperacillin-tazobactam 30 μg), monobactam (aztreonam 30 μg), extended-spectrum cephalosporins (ceftriaxone 30 μg, cefepime 30 μg, cefotaxime 30 μg, cefoxitin 30 μg, and ceftazidime 30 μg), carbapenems (imipenem 30 μg), aminoglycosides (amikacin 30 μg and gentamicin 30 μg), quinolone (ciprofloxacin 30 μg) and trimethoprim-sulfamethoxazole (40 μg). The results of the susceptibility testing were used to calculate the multiple antibiotic resistance (MAR) index for the clinical isolates in order to estimate drug resistance trends and the emergence of new resistant isolates.

Phenotypic detection of MBLs

Phenotypic detection of MBLs was based on three tests according to the CLSI guidelines (2015–2016). The combination disc test, using a disc of imipenem and imipenem with incorporated EDTA, was performed as per the method used by Wadekar, Anuradha [39]. A modified Hodge test (MHT) was performed according to the method used by Kumar et al. [40]. The results for each type of isolate were interpreted according to the criteria defined in CLSI 2016. All antibiotics were obtained from Oxoid, Inc. (Canada). E-strips with IMI and IMP/EDTA were used for epsilometer confirmation of MBLs according to the manufacturer’s instructions (Liofilchem®).

Molecular characterization of MBLs

DNA template preparation for PCR

The template DNA was extracted from isolates using previously described methods [41]. Briefly, a single colony of bacterial isolate was immersed in low TE, and the suspension was boiled for 10 min. The bacterial cell emulsion was centrifuged, and DNA in the supernatant was directly used as a template for PCR amplification.

Detection of ESBL and MBL genes

All of the positive MBL isolates based on phenotypic detection (n = 123) were further confirmed by singleplex and multiplex colony PCR. Multiplex PCR for blaTEM, blaOXA and blaSHV detection was devised. The primer sequences used for the detection of blaTEM, blaOXA and blaSHV genes have been previously reported [42]. Screening for isolates having the blaIMP-1 gene and blaVIM gene was performed by singleplex PCR using previously reported primers [43, 44]. The PCR reaction was set up with a 25 μl mixture containing 10X PCR buffer, 2.5 mM mixture of dNTPs, 20 pmol each primer and 2.5 U of Taq polymerase. The amplification conditions were set with an initial denaturation at 95 °C proceeded by 35 cycles of 1 min denaturation at 95 °C, 1.5 min annealing (temperatures mentioned in Table 1), extension for 1 min and final extension for 10 min at 72 °C. The Mg concentration was maintained between 1 and 1.5 mM.
Table 1

List of the Primers used for the detection of ESBL-Type variant (blaOXA, blaTEM and blaSHV) and MBL-type variants (blaIMP-1 and blaVIM)

Primers

Sequences

Annealing temperature (Tm oC)

References

Expected PCR product

bla IMP-1

AGCGCAGCATATTGATTGC

ACAACCAGATGCTGCCTTACC

53.6

[43]

587

Bla VIM

ATGGTCGTTATGGCATATC

TGGGCCGTGTCAGCCAGAT

57

[44]

510

Bla TEM

CCCCGAAGAAGTCCTTTC

ATCAGCAATAGTCCCAGC

55

[42]

500

Bla SHV

AGGGCTTGACTGCCATTTTG

ATTTGCGTGATTTCATTT

55

[42]

400

Bla OXA

ATATCTCGCTTGTTGCATCTCC

AAACCCTTCAGCTCATCC

55

[42]

600

Statistical analysis

The collected demographic data were statistically analysed using the Statistical Package for Social Sciences (SPSS version 23). The proportions of Acinetobacter spp., Pseudomonas spp. and members of Enterobacteriaceae were calculated using the chi-square test and odds ratios (ORs). A p value of < 0.05 was considered statistically significant. The associations among the type of infection, age, gender and type of isolate were calculated.

Results

Distribution of clinical isolates

In this study, the resistance pattern of imipenem-resistant clinical isolates was assessed, and the incidence of MBL production among these isolates was determined. Moreover, the significant gene variants associated with the MBL phenotype were analysed. Demographic factors and sites of infection were major highlights of the statistical data analysis. Out of a total of 942 isolates, the total frequency of imipenem resistance was calculated to be 56.512% (n = 512). The highest resistance to imipenem was observed for Acinetobacter spp., at 61.89%. Pseudomonas spp. ranked second in terms of the acquisition of imipenem resistance, with a frequency of 61.89%, followed by Klebsiella spp. (50.26%) and Escherichia coli (37.97%). Males were found to be more prone to the acquisition of imipenem-resistant infections (60.69%) compared to females (39.31%). The infectivity rates varied between different age groups, with the maximum mean observed among individuals of the age group 20–40 years. The mean age of individuals acquiring MBL infection was 30 years. Wound infections were found to be the most dominant type of infection (51.70%), followed by urinary tract infections (19.86%), respiratory tract infections (9.6%), and infections associated with indwelling catheters (5.2%).

Antibiotic susceptibility testing of MBL isolates

The panel of antibiotics recommended according to CLSI 2016 guidelines was applied for all isolates belonging to Enterobacteriaceae, Pseudomonas spp. and Acinetobacter spp. Escherichia coli and Klebsiella spp. exhibited susceptibility to gentamycin and piperacillin-tazobactam (23%), amikacin (16%) and sulfamethoxazole/trimethoprim (15%). All the generations of cephalosporins, carbapenem and monobactams showed a complete resistance pattern. Pseudomonas spp. and Acinetobacter spp. presented susceptibility to amikacin and aztreonam (12%), piperacillin-tazobactam (8%), sulfamethoxazole/trimethoprim and gentamycin (7%) and ciprofloxacin (3%). Multiple antibiotic resistance (MAR) index values for > 50% of the isolates fell in the range of 0.81–1.00, and 86% of the Pseudomonas spp. isolates fell in the range of 0.91–1.0. E. coli predominantly had a MAR index value of 0.91–1. A total of 75% of the Klebsiella spp. isolates had a MAR index value ranging between 0.81 and 1.

Phenotypic detection of MBLs

Out of the 906 isolates analysed, 142 randomly selected isolates were suspected to produce metallo-β-lactamases. Among these isolates, 63.38% (n = 90) revealed a positive combination disc test, whereas 36.61% (n = 52) remained non-determinable by CDST. A total of 86.61% (n = 123) of the isolates were confirmed to be MBL producers through the modified Hodge test with meropenem. However, the modified Hodge test with imipenem detected 78.17% (n = 111) of the isolates as positive for MBL production and 22.53% (n = 32) as negative for MBL production. A total of 68% (n = 96%) of the strains were confirmed to exhibit the MBL phenotype through the epsilometer test (E-test).

Multiplex PCR for bla OXA, bla TEM, bla SHV, bla IMP and bla VIM

The presence of blaOXA, blaTEM and blaSHV genes was confirmed in 57.74% (n = 82%) of MBL-producing strains by multiplex PCR. The existence of the blaTEM gene in MBL-producing isolates was found to be the most prevalent, at 46%, followed by the blaSHV gene (34%) and blaOXA gene (24%). blaIMP-1 and blaVIM genes were detected in 12.5% (n = 18) and 7% (n = 10) of strains, respectively. The coexistence of all these genes was determined by multiplex PCR. In total, 60% (49/82) of the MBL-positive strains were found to have the blaOXA, blaTEM and blaSHV genes in coexistence with each other. The blaTEM gene was found to coexist with blaOXA-type variants in 21% (n = 30) of the MBL producers. The combination of blaTEM and blaSHV was detected to be the most common, as exhibited by 24% of the strains. The coexistence of blaOXA and blaSHV genes was observed in 12% of the total isolates. The three genes blaTEM, blaOXA and blaSHV were found to coexist in 9% of the strains (Fig. 1).
Fig. 1
Fig. 1

Frequencies of different gene variants (TEM, SHV, OXA, VIM, IMP) in MBL producing clinical isolates. The presence of genes blaOXA, blaTEM, blaSHV blaIMP-1and blaVIMwas detected in MBL strains through PCR

Statistical analysis

Statistical analysis was performed with SPSS version 23.0 individually for all groups of isolates, including Escherichia coli, Klebsiella spp., Acinetobacter spp. and Pseudomonas spp. (Table 2). The associations among demographic variables, including age, gender and type of infections, were determined by calculating odd ratios and performing the chi-square test. A p-value of < 0.05 was considered statistically significant (Tables 2, 3, 4).
Table 2

Comparison of Carbapenem resistant isolates between different age groups

Age (years)

No. of Isolates

Imipenem

Chi value

OR (95% CI)

p-value

R

S

Escherchia coli

1–9

5

4 (80%)

1 (20%)

2.28 [0.23–22.87]

0.643

10–19

7

4 (57.14%)

3 (42.85%)

 

0.758 [0.157–3.66]

0.704

20–29

38

15 (39.47%)

23 (60.52%)

10.10

0.317 [0.153–0.657]

0.001

30–39

29

9 (31.03%)

20 (68.96%)

7.85

0.308 [0.132–0.723]

0.005

40–49

34

13 (38.23%)

21 (61.76%)

2.45

0.537 [0.245–1.176]

0.117

50–59

32

11 (34.37%)

21 (65.62%)

4.58

0.414 [0.182–0.940]

0.032

60–69

26

8 (30.76%)

18 (69.23%)

5.69

0.316 [0.120–0.831]

0.017

70–79

9

5 (55.55%)

4 (44.44%)

0.809 [0.177–3.69]

1.000

> 79

7

2 (28.57%)

5 (71.42%)

0.150 [0.018–1.237]

0.145

Acinetobacter spp.

1–9

11

8 (66.66%)

4 (33.33%)

1.252

1.8 [0.638–5.072]

0.999

10–19

25

18 (72%)

7 (28%)

3.14

2.015 [0.92–4.41]

0.264

20–29

39

29 (74.35%)

10 (25.64%)

8.05

2.94 [1.37–6.33]

0.076

30–39

42

31 (73.80%)

11 (26.19%)

0.56

1.33 [0.633–2.79]

0.004

40–49

38

21 (55.26%)

17 (44.74%)

6.18

2.94 [1.28–6.73]

0.451

50–59

34

24 (70.58%)

10 (29.41%)

3.87 [1.26–11.81]

0.009

60–69

20

15 (75%)

5 (25%)

1.031 [0.23–4.53]

0.026

70–79

10

6 (60%)

4 (40%)

 

0.999

> 79

4

4 (100%)

0 (0%)

   

Klebsiella spp.

1–9

11

6 (54.54%)

5 (45.45)

0.870

0.505 [0.119–2.145]

0.351

10–19

10

6 (60%)

4 (40%)

0.857 [0.220–3.343]

1.000

20–29

40

22 (55%)

18 (45%)

1.040

0.695 [0.345–1.401]

0.824

30–39

41

19 (46.34%)

22 (53.65%)

1.52

0.645 [0.320–1.299]

0.218

40–49

26

15 (57.69%)

11 (42.30%)

0.749

1.458 [0.619–3.43]

0.387

50–59

26

8 (30.76%)

18 (69.23%)

5.230

0.356 [0.143–0.883]

0.022

60–69

19

9 (47.36%)

10 (52.63)

0.097

0.851 [0.309–2.343]

0.755

70–79

11

8 (72.72%)

3 (27.27%)

2.286 [0.493–10.605]

0.466

> 79

5

2 (40%)

3 (60%)

0.417 [0.051–3.435]

0.608

Pseudomonas spp.

1–9

9

6 (66.67%)

3 (33.34%)

1.05 [0.22–5.13]

1.000

10–19

34

20 (58.83%)

14 (41.17%)

0.497

0.71 [0.28–1.82]

0.481

20–29

75

54 (72%)

21 (28%)

5.093

2.02 [1.09–3.74]

0.024

30–39

61

38 (62.29%)

23 (37.70%)

2.127

1.59 [0.85–3.00]

0.145

40–49

44

23 (52.27%)

21 (47.72)

0.130

1.14 [0.56–2.31]

0.718

50–59

51

30 (58.83%)

21 (41.17%)

1.917

1.63 [0.81–3.25]

0.166

60–69

25

14 (56%)

11 (44%)

0.410

1.35 [0.54–3.41]

0.522

70–79

6

3 (50%)

3 (50%)

0.63 [0.11–3.66]

0.670

> 79

2

2 (100%)

0

0.477

*OR Odd ratio&** p value < 0.05 is considered as statistically significant

Table 3

Association of imipenem resistant isolates with type of clinical specimens

Isolate

Sample

(N)

Imipenem

Chi value

OR

p-value

R

S

Escherichia coli

Wound

65

22

43

23.013

0.276 [0.159–0.478]

0.000

Fluids & Effusion

13

3

10

0.123 [0.027–0.553]

0.007

Tips & Catheters

6

5

1

1.833 [0.192–17.48]

1.00

Urine

79

34

45

0.894

0.756 [0.422–1.351]

0.344

Sputum

12

5

7

0.096

0.824 [0.242–2.806]

0.757

Others

14

4

10

0.403 [0.290–0.559]

0.070

Acinetobacter spp.

Wound

130

92

38

7.16

1.79 [1.16–2.75]

0.006

Fluids & Effusion

13

11

2

6.67 [1.26–35.28]

0.021

Tips & Catheters

22

17

5

0.171

1.32 [0.35–4.97]

0.679

Urine

21

11

10

0.265

1.27 [0.51–3.15]

0.606

Sputum

25

15

10

2.73

2.17 [0.85–5.50]

0.098

Others

13

10

3

4.38 [1.05–18.17]

0.056

Klebsiella spp.

Wound

71

43

28

0.004

0.983 [0.59–1.64]

0.947

Fluids & Effusion

11

6

5

0.031

0.88 [0.22–3.49]

0.861

Tips & Catheters

10

7

3

0.75 [0.16–3.52]

0.700

Urine

58

25

33

0.534

0.79 [0.43–1.48]

0.465

Sputum

30

13

17

0.110

0.86 [0.36–2.06]

0.740

Others

10

4

6

0.59 [0.15–2.35]

0.504

Pseudomonas spp.

Wound

221

142

79

1.84

1.29 [0.89–1.85]

0.174

Fluids & Effusion

7

5

2

2.12 [0.36–12.38]

0.680

Tips & Catheters

9

6

3

0.62 [0.13–2.99]

0.674

Urine

29

19

10

4.669

2.44 [1.06–5.58]

0.031

Sputum

23

9

14

0.547

0.69 [0.27–1.81]

0.459

Others

20

11

9

0.210

1.29 [0.43–3.84]

0.647

*OR Odd ratio&** p value < 0.05 is considered as statistically significant

Table 4

Comparison of infection rate between male and female

Isolates

Gender

(N)

Imipenem

Chi value

OR*

p-value**

R

S

Escherichia coli

Male

106

41

65

0.0067

1.025 [0.57–1.85]

0.934

Female

84

32

52

Acinetobacter spp.

Male

136

94

42

41.05

4.51 [2.81–7.24]

0.0001

Female

90

63

127

Klebsiella spp.

Male

97

57

40

4.67

1.87 [1.058–3.328]

0.03

Female

95

41

54

Pseudomonas spp.

Male

203

125

78

0.0017

0.98 [0.61–1.59]

0.483

Female

110

68

42

*OR Odd ratio&** p value < 0.05 is considered as statistically significant

Discussion

Pakistan is a country where empirical drug therapy and misuse of antibiotics are common practice. Poor sanitation, filthy practices in clinical settings, and ill-informed health care workers are factors in the dissemination of nosocomial pathogensto the community. Routinely used second-generation drugs are quickly being replaced by drugs of last resort, and this situation is ultimately an enduring threat to mankind. According to one estimate, first-line antibiotic-resistant pathogens account for 25,692 neonatal deaths annually in Pakistan [45]. Resistance to carbapenems has been significantly observed in Asian countries, including Pakistan [30, 46, 47]. At present, numerous reports of MBL producers and ESBL producers from Pakistan present clinical catastrophes and alarming health issues [41, 48, 49]. The present study demonstrates the frequency of imipenem resistance among clinical isolates and the incidence of MBLS producers associated with imipenem resistance in connection with various demographic factors and types of infection. The frequency of imipenem resistance in our study was 56%, which is significantly higher than the data reported from Asian countries in the last decade (2002–2012), with one epidemiological study reporting 1.9% resistance to imipenem and 2.4% resistance to meropenem [4].

Comparison of the antibiotic resistance profiles of all the pathogens with those reported in other recent studies has revealed relatively similar patterns. The resistance pattern of Acinetobacter spp. to imipenem in our study (61.89%) is in conformity with reports by Anwar et al., but a lower rate (77.5%) of imipenem resistance in this region was reported by Shamim et al. [50]. Acinetobacter spp., the pathogen renowned for hospital-acquired infections, was predominantly found to be associated with wound infections and was the causative agent of 92% infections associated with imipenem resistance. Pseudomonas spp. was the second most prominent pathogen associated with the acquisition of imipenem resistance, with a frequency of 61.89%, and has been noted in other reports from Pakistan, presenting imipenem resistance rates of 13.42% in 2011 and of 28% and 49.5% in 2015, thus demonstrating a sharp rise in the frequency of imipenem resistance [49, 51, 52]. The victims of Pseudomonas spp. infections were found predominantly in the group of patients with post-burn infections. This finding is in conformity with studies on invasive burn wound infections that document P. aeruginosa as a leading pathogen among gram-negative organisms [53, 54]. Wound infections were particularly found to be associated with Acinetobacter spp. (OR = 1.79 [1.16–2.75]) and Pseudomonas spp. *OR = 1.29 [0.89–1.85]).

The incidence of MBL among imipenem-resistant Acinetobacter spp. was calculated to be 89%, which is comparable to that reported in a study by Anwar et al., presenting a frequency of 83.3% MBLs among carbapenem-resistant isolates [55]. A total of 78% of the imipenem-resistant Pseudomonas spp. isolates were detected to be MBL producers by the MHT test, representing a lower incidence compared to the study by Shan et al. that stated the incidence rate to be 87.5% [49].

Our study demonstrates the OXA-type variants to be predominantly associated with resistance to imipenem. All of the isolates harbouring blaIMP were also found to harbour blaTEM. Despite the uncommon origin of two major groups of β-lactamases, blaESBL and blaMBL, their association is imminent according to recent research [10]. We analysed the isolates for the coexistence of MBL-type and ESBL-type variants. The blaVIM gene variant for MBL production was also found to be in coexistence with blaTEM and blaSHV in Providencia stuartii and Enterobacter spp. A total of 12.5% isolates were found to coexhibit the blaIMP-1 and blaSHV genes, whereas 10% were positive for the blaOXA gene along with the blaIMP-1 gene.

The abovementioned mechanism of coexistence of genes has been reported in Klebsiella pneumoniae, Escherichia coli, Salmonella spp. and Enterobacter spp. [56]. Plasmids containing the blaNDM-1 gene have been observed to coexhibit genes for CTX-M, TEM-1 and OXA-1 enzymes. Major ESBL and MBL genes, including blaCTX-M, blaSHV, blaTEM, and blaOXA-51, and genes for the VIM-family and IMP-family, have been reported to coexist in clinically resistant Acinetobacter baumannii in Iran [57]. However, one study concluded that there was no significant relationship between ESBL and MBL production genes [57]. Ertapenem-resistant, ESBL-producing Klebsiella pneumoniae isolates have been reported in Italy and shown to carry novel porin variants that contributed to the reduced susceptibility of isolates to meropenem and imipenem [58].

The coexistence of the genes for MBL and ESBL variants in our isolates indicates the simultaneity of the emergence of different variants of β-lactamases among pathogens in our clinical settings. This finding also suggests that the resistance against imipenem in our isolates is mediated by MBL-type enzymes along with the overproduction of ESBL-type enzymes, as suggested by other studies [5, 7]. To the best of our knowledge, this is the first study from Pakistan reporting the coexistence of blaIMP with blaTEM-type and SHV-type variants. None of the isolates was found to coexhibit all the tested genes (blaOXA, blaTEM, blaSHV, blaIMP-1 and blaVIM).

Conclusion

In conclusion, ESBL- and MBL-producing bacterial isolates are emerging very rapidly in the region. A great number of carbapenem-resistant clinical bacterial species are resistant to most of the commonly used antibiotics, demonstrating the rise of super-bacteria and their pan-resistance to antimicrobial therapy. Determining the resistance mechanisms and the root cause for their elimination are of great importance. It is also important to implement the routine screening of ESBLs and MBLs in laboratory procedures before antibiotic therapy begins. Further studies are required to specify other types of gene variants prevalent among clinical isolates in our region for the implication of medication in clinical settings.

Abbreviations

CDST: 

Combination disc test

DDST: 

Double disc synergy test

E test: 

Epsilometer test

ESBLs: 

Extended-spectrum β-lactamase-producing strains

ESBLs: 

Extended-spectrum β-lactamases

MBLs: 

Metallo-β-lactamases

MDR: 

Multidrug-resistant

MIC: 

Minimum inhibitory concentration

Declarations

Acknowledgements

This work was funded by the Department of Microbiology and Molecular Genetics, University of the Punjab. The project was established in collaboration with Allama Iqbal Medical College, Lahore, for sample and data collection. The efforts of Mr. Muhammad Umar Farooq, Biostatistician & Incharge IT, Institute of Public Health (IPH), Lahore, is highly acknowledged for his efforts in performing the data analysis. The authors would like to thank Dr. Muhammad Faisal, CEO of Citilab and the research centre, for his valuable and collaborative suggestions.

Funding

No funding was received for this study.

Availability of data and materials

The data sets analysed during the current study are available from the corresponding author.

Declaration

This study is part of the Ph.D. thesis of Noor-Ul-Ain.

Authors’ contributions

NUA, SR, and FR designed the study. NUA, AI, SSB and SH performed the experimental work. AI, SSB, and MHH collected the data. NUA, SA, and MHH analysed the data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was approved by the local ethics committee (CitiLab and Research Centre Ref # 30th − 15 CLRC/ 30th).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Microbiology and Molecular Genetics, University of the Punjab, Lahore, 5400, Pakistan
(2)
Department of Pathology, Allama Iqbal Medical College, Lahore, Pakistan
(3)
Citilab and Research Center, Lahore, Pakistan

References

  1. Baran I, Aksu N. Phenotypic and genotypic characteristics of carbapenem-resistant Enterobacteriaceae in a tertiary-level reference hospital in Turkey. Ann Clin Microbiol Antimicrob. 2016;15(1):20.View ArticleGoogle Scholar
  2. Khalifa HO, et al. High carbapenem resistance in clinical gram-negative pathogens isolated in Egypt. Microb Drug Resist. 2017;23(7):838–44.View ArticleGoogle Scholar
  3. Mirsalehian A, et al. Determination of carbapenem resistance mechanism in clinical isolates of Pseudomonas aeruginosa isolated from burn patients, in Tehran, Iran. Journal of epidemiology and global health. 2017;7(3):155–9.View ArticleGoogle Scholar
  4. Xu Y, et al. Epidemiology of carbapenem resistant Enterobacteriaceae (CRE) during 2000-2012 in Asia. Journal of thoracic disease. 2015;7(3):376.PubMedPubMed CentralGoogle Scholar
  5. Satlin MJ, et al. Multicenter clinical and molecular epidemiological analysis of bacteremia due to carbapenem-resistant Enterobacteriaceae (CRE) in the CRE epicenter of the United States. Antimicrob Agents Chemother. 2017;61(4):e02349–16.View ArticleGoogle Scholar
  6. Wang, J.-T., et al., Carbapenem-nonsusceptible enterobacteriaceae in Taiwan. PLoS One, 2015. 10(3): p. e0121668.View ArticleGoogle Scholar
  7. Ye Y, et al. Mechanism for carbapenem resistance of clinical Enterobacteriaceae isolates. Experimental and Therapeutic Medicine. 2018;15(1):1143–9.PubMedGoogle Scholar
  8. Dalmolin TV, et al. Detection and analysis of different interactions between resistance mechanisms and carbapenems in clinical isolates of Klebsiella pneumoniae. Braz J Microbiol. 2017;48(3):493–8.View ArticleGoogle Scholar
  9. Zafer MM, et al. Antimicrobial resistance pattern and their beta-lactamase encoding genes among Pseudomonas aeruginosa strains isolated from cancer patients. Biomed Res Int. 2014:2014.Google Scholar
  10. Iraz M, et al. Distribution of β-lactamase genes among carbapenem-resistant Klebsiella pneumoniae strains isolated from patients in Turkey. Annals of laboratory medicine. 2015;35(6):595–601.View ArticleGoogle Scholar
  11. Yong D, et al. Characterization of a new metallo-β-lactamase gene, blaNDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53(12):5046–54.View ArticleGoogle Scholar
  12. Bush K, Jacoby GA, Medeiros AA. A functional classification scheme for beta-lactamases and its correlation with molecular structure. Antimicrob Agents Chemother. 1995;39(6):1211.View ArticleGoogle Scholar
  13. Walsh TR. Clinically significant carbapenemases: an update. Curr Opin Infect Dis. 2008;21(4):367–71.View ArticleGoogle Scholar
  14. Nordmann P, Poirel L. Emerging carbapenemases in gram-negative aerobes. Clin Microbiol Infect. 2002;8(6):321–31.View ArticleGoogle Scholar
  15. Haruta S, et al. Functional analysis of the active site of a metallo-β-lactamase proliferating in Japan. Antimicrob Agents Chemother. 2000;44(9):2304–9.View ArticleGoogle Scholar
  16. Ito H, et al. Plasmid-mediated dissemination of the metallo-beta-lactamase gene blaIMP among clinically isolated strains of Serratia marcescens. Antimicrob Agents Chemother. 1995;39(4):824–9.View ArticleGoogle Scholar
  17. Hawkey PM, et al. Occurrence of a new metallo-β-lactamase IMP-4 carried on a conjugative plasmid in Citrobacter youngae from the People's Republic of China. FEMS Microbiol Lett. 2001;194(1):53–7.PubMedGoogle Scholar
  18. Hawkey P. Multidrug-resistant gram-negative bacteria: a product of globalization. J Hosp Infect. 2015;89(4):241–7.View ArticleGoogle Scholar
  19. Munita JM, Arias CA. Mechanisms of antibiotic resistance. Microbiology spectrum. 2016;4(2).Google Scholar
  20. Scoulica EV, et al. Spread of Bla VIM-1-producing. E coli in a university hospital in Greece Genetic analysis of the integron carrying the bla VIM-1 metallo-β-lactamase gene Diagnostic microbiology and infectious disease. 2004;48(3):167–72.Google Scholar
  21. Cornaglia G, Giamarellou H, Rossolini GM. Metallo-β-lactamases: a last frontier for β-lactams? Lancet Infect Dis. 2011;11(5):381–93.View ArticleGoogle Scholar
  22. Kazmierczak, K.M., et al., Multi-year, multi-national survey of the incidence and global distribution of metallo-β-lactamase-producing Enterobacteriaceae and P. aeruginosa. Antimicrob Agents Chemother, 2015: p. AAC. 02379–15.Google Scholar
  23. Rolain J, Parola P, Cornaglia G. New Delhi metallo-beta-lactamase (NDM-1): towards a new pandemia? Clin Microbiol Infect. 2010;16(12):1699–701.View ArticleGoogle Scholar
  24. Berrazeg M, et al. New Delhi Metallo-beta-lactamase around the world: an eReview using Google maps. Eurosurveillance. 2014;19(20):20809.View ArticleGoogle Scholar
  25. Pfeifer Y, et al. Molecular characterization of Bla NDM-1 in an Acinetobacter baumannii strain isolated in Germany in 2007. J Antimicrob Chemother. 2011;66(9):1998–2001.View ArticleGoogle Scholar
  26. Bonnin R, et al. Dissemination of New Delhi metallo-β-lactamase-1-producing Acinetobacter baumannii in Europe. Clin Microbiol Infect. 2012;18(9):E362–5.View ArticleGoogle Scholar
  27. Nakazawa Y, et al. A case of NDM-1-producing Acinetobacter baumannii transferred from India to Japan. J Infect Chemother. 2013;19(2):330–2.View ArticleGoogle Scholar
  28. Kumarasamy KK, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis. 2010;10(9):597–602.View ArticleGoogle Scholar
  29. Litzow JM, et al. High frequency of multidrug-resistant gram-negative rods in 2 neonatal intensive care units in the Philippines. Infection Control & Hospital Epidemiology. 2009;30(6):543–9.View ArticleGoogle Scholar
  30. Le NK, et al. High prevalence of hospital-acquired infections caused by gram-negative carbapenem resistant strains in Vietnamese pediatric ICUs: a multi-Centre point prevalence survey. Medicine. 2016;95(27).View ArticleGoogle Scholar
  31. Bhat V, et al. Bacteriological profile and antibiotic susceptibility patterns of clinical isolates in a tertiary care cancer center. Indian journal of medical and paediatric oncology: official journal of Indian Society of Medical & Paediatric Oncology. 2016;37(1):20.View ArticleGoogle Scholar
  32. Walther-Rasmussen J, Høiby N. OXA-type carbapenemases. J Antimicrob Chemother. 2006;57(3):373–83.View ArticleGoogle Scholar
  33. Bonnin RA, Poirel L, Nordmann P. AbaR-type transposon structures in Acinetobacter baumannii. J Antimicrob Chemother. 2011;67(1):234–6.View ArticleGoogle Scholar
  34. Khan M, et al. Emerging bacterial resistance patterns in febrile neutropenic patients: experience at a tertiary care hospital in Pakistan. JPMA. The Journal of the Pakistan Medical Association. 2004;54(7):357–60.PubMedGoogle Scholar
  35. Irfan S, et al. Molecular and epidemiological characterisation of clinical isolates of carbapenemresistant Acinetobacter baumannii from public and private sector intensive care units in Karachi, Pakistan. J Hosp Infect. 2011;78(2):143–8.View ArticleGoogle Scholar
  36. Khan F, Khan A, Kazmi SU. Prevalence and susceptibility pattern of multi drug resistant clinical isolates of Pseudomonas aeruginosa in Karachi. Pakistan journal of medical sciences. 2014;30(5):951.PubMedPubMed CentralGoogle Scholar
  37. Kaleem F, et al. Frequency and susceptibility pattern of metallo-beta-lactamase producers in a hospital in Pakistan. The Journal of infection in developing countries. 2010;4(12):810–3.View ArticleGoogle Scholar
  38. Bauer A, et al. Antibiotic susceptibility testing by a standardized single disk method. Am J Clin Pathol. 1966;45(4):493.View ArticleGoogle Scholar
  39. Wadekar MD, Anuradha K, Venkatesha D. Phenotypic detection of ESBL and MBL in clinical isolates of Enterobacteriaceae. Int J Current Res Acad Rev. 2013;1(3):89–5.Google Scholar
  40. Kumar S, Mehra S. Performance of modified Hodge test and combined disc test for detection of Carbapenemases in clinical isolates of Enterobacteriaceae. Int J Curr Microbiol App Sci. 2015;4(5):255–61.Google Scholar
  41. Abrar S, et al. Distribution of CTX-M group I and group III β-lactamases produced by Escherichia coli and klebsiella pneumoniae in Lahore, Pakistan. Microb Pathog. 2017;103:8–12.View ArticleGoogle Scholar
  42. Colom K, et al. Simple and reliable multiplex PCR assay for detection of blaTEM, blaSHV and blaOXA–1 genes in Enterobacteriaceae. FEMS Microbiol Lett. 2003;223(2):147–51.View ArticleGoogle Scholar
  43. Shibata N, et al. PCR typing of genetic determinants for metallo-β-lactamases and integrases carried by gram-negative bacteria isolated in Japan, with focus on the class 3 integron. J Clin Microbiol. 2003;41(12):5407–13.View ArticleGoogle Scholar
  44. Galani I, et al. First identification of an Escherichia coli clinical isolate producing both metallo-β-lactamase VIM-2 and extended-spectrum β-lactamase IBC-1. Clin Microbiol Infect. 2004;10(8):757–60.View ArticleGoogle Scholar
  45. Laxminarayan R, Bhutta ZA. Antimicrobial resistance—a threat to neonate survival. Lancet Glob Health. 2016;4(10):e676–7.View ArticleGoogle Scholar
  46. Sekar R, et al. Carbapenem resistance in a rural part of southern India: Escherichia coli versus Klebsiella spp. Indian J Med Res. 2016;144(5):781.View ArticleGoogle Scholar
  47. Hu F-P, et al. Resistance trends among clinical isolates in China reported from CHINET surveillance of bacterial resistance, 2005–2014. Clin Microbiol Infect. 2016;22:S9–S14.View ArticleGoogle Scholar
  48. Ilyas M, et al. Frequency, susceptibility and co-existence of MBL, ESBL & AmpC positive Pseudomonas aeruginosa in tertiary care hospitals of Peshawar, KPK. In: Pakistan; 2015.Google Scholar
  49. Shan S, Sajid S, Ahmad K. Detection of Bla IMP gene in Metallo-β-lactamase producing isolates of imipenem resistant Pseudomonas aeruginosa; an alarming threat. Journal of Microbiology Research. 2015;5(6):175–80.Google Scholar
  50. Shamim S, Abbas M, Qazi MH. Prevalence of multidrug resistant Acinetobacter baumannii in hospitalized patients in Lahore. Pakistan Pakistan J Mol Med. 2015;2(1):23–8.Google Scholar
  51. Ameen N, et al. Imipenem resistant Pseudomonas aeruginosa: the fall of the final quarterback. Pakistan journal of medical sciences. 2015;31(3):561.PubMedPubMed CentralGoogle Scholar
  52. Bashir D, et al. Detection of metallo-beta-lactamase (MBL) producing Pseudomonas aeruginosa at a tertiary care hospital in Kashmir. Afr J Microbiol Res. 2011;5(2):164–72.Google Scholar
  53. Church D, et al. Burn wound infections. Clin Microbiol Rev. 2006;19(2):403–34.View ArticleGoogle Scholar
  54. AL-Aali KY. Microbial profile of burn wound infections in burn patients, Taif. Saudi Arabia Archives of Clinical Microbiology. 2016;7(2).Google Scholar
  55. Anwar M, et al. Phenotypic detection of Metallo-Beta-lactamases in Carbapenem resistant Acinetobacter baumannii isolated from pediatric patients in Pakistan. Journal of pathogens. 2016:2016.Google Scholar
  56. Nordmann P, Dortet L, Poirel L. Carbapenem resistance in Enterobacteriaceae: here is the storm! Trends Mol Med. 2012;18(5):263–72.View ArticleGoogle Scholar
  57. Safari M, et al. Prevalence of ESBL and MBL encoding genes in Acinetobacter baumannii strains isolated from patients of intensive care units (ICU). Saudi journal of biological sciences. 2015;22(4):424–9.View ArticleGoogle Scholar
  58. García-Fernández A, et al. An ertapenem-resistant extended-spectrum-β-lactamase-producing Klebsiella pneumoniae clone carries a novel OmpK36 porin variant. Antimicrob Agents Chemother. 2010;54(10):4178–84.View ArticleGoogle Scholar

Copyright

© The Author(s). 2018

Advertisement