Skip to main content

Table 1 Primer sequences and PCR product sizes of the florfenicol resistance genes

From: Characterization of florfenicol resistance genes in the coagulase-negative Staphylococcus (CoNS) isolates and genomic features of a multidrug-resistant Staphylococcus lentus strain H29

Primer Sequence (5′–3′) Amplicon size (bp) Annealing temperature (°C) References
floR1-F ATGACCACCACACGCCCCGCGTGGGC 1198 58 [7]
floR1-R CTTCGATCCCGCGACGTTCCTTCCGAGA    
fexA1-F CTCTTCTGGACAGGCTGGAA 332 57 [6]
fexA1-R CCAGTTCCTGCTCCAAGGTA    
fexB1-F ACTGGACAGGCAGGCTTAAT 319 57 [8]
fexB1-R CCTGCCCCAAGATACATTGC    
cfr1-F GGGAGGATTTAATAAATAATTTTGGAGAAACAG 580 58 [7]
cfr1-R CTTATATGTTCATCGAGTATATTCATTACCTCATC    
optrA1-F CTTATGGATGGTGTGGCAGC 309 56 [11]
optrA1-R CCATGTGGTTTGTCGGTTCA    
pexA1-F GTTGTGGTCTTTGGCCAGAG 318 56 [9]
pexA1-R TCCATCAAGAGGACACCACC