Skip to main content

Table 3 DNA sequences used for SPED synthesis

From: Silica nanoparticles with encapsulated DNA (SPED) to trace the spread of pathogens in healthcare

Name Sequence
SPED-1 forward TTATGGGCTCTAAGGATCTCTTCGTTGTCGTTAGGTTCCTGCGTTTTTCGATTCGAGGGTGAGTT
SPED-1 reverse AACTCACCCTCGAATCGAAAAACGCAGGAACCTAACGACAACGAAGAGATCCTTAGAGCCCATAA
SPED-2 forward TATGCGCCTTTATACTCTTATAGGTATCCTGTTGCTGGCACTTTTTTCTAGCAAAGTCTTCTCCT
SPED-2 reverse AGGAGAAGACTTTGCTAGAAAAAAGTGCCAGCAACAGGATACCTATAAGAGTATAAAGGCGCATA
SPED-3 forward TAGCTCGTTCATAGAATCACTTCGCCGTACTCAACGTAGTGGTTTTTGTTTAGCTCAAACAGGTT
SPED-3 reverse AACCTGTTTGAGCTAAACAAAAACCACTACGTTGAGTACGGCGAAGTGATTCTATGAACGAGCTA