Open Access

High prevalence of the mcr-1 gene in retail chicken meat in the Netherlands in 2015

Antimicrobial Resistance & Infection Control20176:83

https://doi.org/10.1186/s13756-017-0242-8

Received: 1 June 2017

Accepted: 9 August 2017

Published: 18 August 2017

Abstract

Recently, plasmid-mediated colistin resistance was reported in humans, animals and food. We studied the presence of mcr-1 and mcr-2 in Dutch retail chicken meat. The prevalence of mcr-1 was 24,8% (53/214), whereas mcr-2 was not found. The presence of mcr-1-positive Enterobacteriaceae was confirmed by culture in 34/53 samples (64,2%). The prevalence depended on the supermarket chain and was lower in free-range chicken samples. The unexpected high prevalence of mcr-1 in food is cause for concern.

Keywords

Colistin resistance Chicken meat mcr-1 Netherlands Prevalence PCR method Enterobacteriaceae

Article

Recently, a plasmid-mediated colistin resistance gene, called mcr-1, was reported from China [1], which was soon followed by several reports on mcr-1 positive Enterobacteriaceae from food, animals and the environment across the world [2, 3]. This is of particular concern as colistin is currently considered as a last resort agent for treatment of infections with isolates that contain other resistance traits, like extended-spectrum beta-lactamase (ESBL) producing Enterobacteriaceae or carbapenem-resistant bacteria [46].

Recent investigations using metagenomics, indicated a substantial larger environmental reservoir regarding the mcr-1 gene in the Chinese population [7]. This indicates that other approaches are needed to reveal the true reservoir of mcr-1.

In the Netherlands, mcr-1 was detected at low prevalence in E. coli isolates from livestock and meat (< 2%) and at very low frequencies in the human population [6, 8, 9]. The aim of this study was to determine the prevalence of mcr-1 and mcr-2 in a collection of poultry samples from Dutch supermarkets using a PCR-based method.

Collection and analysis of retail chicken samples

Chicken meat samples (n = 214) were bought from four supermarket chains throughout the Netherlands in 2015. The number of samples was balanced across supermarkets and one sample per production batch was included. Meat samples were enriched overnight in non-selective tryptic soy broth (TSB) and subsequently stored at -80 °C until further testing. DNA was isolated from 50 μl of the defrosted TSB using NucliSens EasyMAG (Biomérieux). Detection of mcr-1 and mcr-2 gene was performed by real-time multiplex PCR (ABI 7500 system) using the following primers and probes: mcr1-2_forward AAATGCCMTRCARACCGACCAAG, mcr-1-2_reverse TCTCACCGACGACGAACACCAC, mcr-1_probe YY-BHQ1 TTTGATGCGCCGATTGGGCTTGATC, mcr-2 probe FAM-BHQ1 TGCAGACCACCAAGCCGAGCGAG. Control isolates that contained either mcr-1 or mcr-2 were used. Concurrently, 100 μl of TSB was inoculated in fresh TSB and incubated at 35-37°C overnight. Subsequently, 10 μl of this overnight grown TSB was streaked onto a CLED-colistin-agar with 1.5 μg/ml colistin (Duchefa) and 10 μg/ml Daptomycin (Novartis). All colistin resistant isolates that could grow on the selective CLED-colistin-agar were confirmed by Vitek MS (Biomérieux) and non-intrinsic colistin resistant isolates found, were further tested for the presence of mcr genes by PCR. The isolates were tested by broth-micro-dilution (BMD), in cation-adjusted Mueller Hinton broth [10], for colistin susceptibility and Vitek2 (AST N344) (Biomérieux) to determine the susceptibility for various other antibiotics.

Prevalence of MCR-1 in retail chicken samples

The prevalence of mcr-1 on retail chicken meat using PCR on TSB was 24.8% (53/214 samples positive) and no mcr-2 was detected. Using a selective culture method, the presence of mcr-1 was confirmed in 34 of these 53 (64.2%) samples with a positive result by PCR. Using this culture method, intrinsically resistant isolates had the ability to grow as well. No mcr-positive Enterobacteriaceae were found in all other samples. E. coli was identified in 32 samples, and K. pneumoniae in two samples. The median CT-value of the culture positive samples was significantly lower: culture-positive, 25.6 and culture-negative, 30.1, (p < 0.001, Mann-Whitney U-test).

The prevalence of mcr-1 according to the method of farming husbandry (free range: yes/no) and supermarket chain is shown in Table 1. Using multivariable regression analysis it was shown that both variables were statistically significant and independently related to the presence of mcr-1. We also investigated the country of origin (COO), as indicated on the label (Table 1). This variable showed co-linearity with the supermarket chain and was not included in the multivariate analysis (Fig. 1).
Table 1

Determinants of the presence of mcr-1 in Dutch retail chicken meat samples, 2015

Determinant

Samples

n = 214

mcr-1 PCR positive

n (%)

OR (95% CI)

Adjusted OR (95%CI)

Labelling as free-range

 Yes

70

10 (14.3)

reference

reference

 No

144

43 (29.8)

2.6 (1.2-5.5)

3.0 (1.3-6.6)

Supermarket chain

 A

53

1 (1.9)

reference

reference

 B

53

10 (18.9)

12.1 (1.5-98.3)

12.5 (1.5-101.8)

 C

54

21 (38.9)

33.1 (4.2-257.8)

34.6 (4.4-272.0)

 D

54

21 (38.9)

33.1 (4.2-257.8)

37.5 (4.8-295.3)

Country of origina

 NL

67

21 (30.3)

2.9 (1.3-6.5)

 

 GER

44

19 (43.2)

4.8 (2.0-11.4)

 

 DEN

9

1 (11.1)

0.8 (0.1-6.9)

 

 NL/GER

80

11 (13.8)

reference

 

 NL/GER/BE

12

0 (0.0)

not applicable

 

 Unknown

2

1 (50.0)

6.3 (0.4-107.8)

 

a NL The Netherlands, GER Germany, DEN Denmark, BE Belgium

Fig. 1

Distribution of the mcr-1 positive and negative chicken meat samples across supermarket chains and country of origin (n = 214)

The in vitro antimicrobial susceptibility for the 35 mcr-1 positive isolates, which were found by culture, is shown in Table 2. One sample (nr. 11) harboured two isolates which were mcr-1 positive but with different susceptibility patterns. There were high levels of resistance against ampicillin (100%), amoxicillin-clavulanic acid (89%), trimethoprim/sulfamethoxazol (69%) and ciprofloxacin (57%). Only one mcr-1 positive ESBL-producer was found (sample 34) and all isolates were susceptible to meropenem.
Table 2

Antimicrobial susceptibility of mcr-1 positive Enterobacteriaceae isolated from Dutch retail chicken meat, 2015

a BMD broth micro-dilution

bVitek2

cPhenotypic confirmed extended-spectrum beta-lactamase- producing E. coli

Red in the table represents resistant, yellow intermediate and green suscpetible for the given antibiotics according to EUCAST guidelines

Discussion

In this study, a PCR-based detection method identified an unexpected high prevalence (24.8%) of mcr-1 in retail chicken meat samples and no mcr-2 was found. The majority of the PCR positive samples were confirmed by selective culture. The 19 PCR positive samples that could not be confirmed by culture were all overgrown by intrinsically colistin-resistant bacterial species (e.g. Serratia spp. and Proteus spp.), which decreases the sensitivity of the culture for mcr-1 harbouring bacteria. In addition, the higher CT-values in the culture-negative samples are indicative of a lower bacterial load, which may further explain the negative findings. Moreover, the freeze-thaw step of the samples might have played a role in the viability of the colistin-resistant bacteria.

A link between mcr-1 in humans and food has been proposed in the first report from China, in which 28% of poultry samples harboured mcr-1 [1]. In a study from south America, chicken meat was also identified as a reservoir for mcr-1-harboring E.coli isolates (19.5%) based on a selective culture approach. It should be realized that Brazil is the third-largest chicken meat producer and the largest exporter of this product [11]. Subsequent studies confirmed the presence of mcr-1 in isolates from poultry and other meat products from Europe, but at much lower rates [2]. A recent study form Germany, including 580 E. coli isolates from chicken meat, found a decreasing prevalence of mcr-1, from 8.1% in 2011 to 0.5% in 2014, however, this was based on isolate screening [12].

At present, mcr-1 is only sporadically found in humans in the Netherlands [6, 8, 9]. This is in a situation where colistin and other polymyxins are used at very low levels. In 2014, polymyxins constituted less than 0.1% (0.01 defined daily dose (DDD)/1000 inhabitant-days) of all systemic antimicrobials used in primary care and 0.3% (0.2 DDD/100 patient-days) in the hospital setting [13]. Therefore, the selective pressure is currently low. Also, it should be taken into account that more selective approaches are necessary to reveal the true presence of mcr-1 in humans. Both the current study and the study by Wang et al. show that direct molecular techniques, molecular techniques after enrichment steps and selective culture techniques result in much higher prevalences compared to studies using non-targeted methods [7]. Considering the low selective pressure in humans and the lack of data on the resistome in humans it is not evident what the implications of these findings are for public health on the short or long term.

The culture approach showed that the majority of the mcr-1 positive isolates were susceptible to cephalosporins, carbapenems and aminoglycosides. Apparently, the mcr-1 gene is frequently present in isolates that are susceptible to most classes of antibiotics. This might explain the relative low prevalence of mcr-1 in studies that have primarily focused on isolates with other resistance traits [6, 1417].

The differences in mcr-1 prevalence between supermarket chains are remarkable, with the two chains with the highest prevalence (C and D) having an odds ratio that is approximately 35 times higher compared to the supermarket chain with the lowest prevalence, after adjusting for free-range rearing of the animals. We attempted to extend the multivariable regression analysis to study the reservoir of the mcr-1 gene to COO. However, in most cases, multiple countries are named on one sample without further specification. In addition, there was co-linearity with the supermarket chain (Fig. 1), prohibiting to include these variables in the regression model. Further details on the production process could not be studied as the label on the package does not provide further information. The conclusion is that there are large differences in the prevalence of mcr-1 between supermarkets which we cannot explain with the available information. As shown in Table 2, there were variable susceptibility patterns to other antibiotics, which showed a tendency to cluster within supermarket chains. We cannot draw conclusions based on these data. This would require additional research. It would be important to extend the investigations into the different chains of production of chicken meat to identify the determinants of the presence of mcr-1.

In conclusion, we have shown a high prevalence of mcr-1 in chicken meat with a large and unexplained variation between supermarket chains. The approach, specifically targeting the presence of mcr-1, resulted in a much higher prevalence than previous studies that did not specifically target colistin resistance. These findings warrant further studies to elucidate the underlying mechanisms of spread and the genetic location of the mcr-1 gene. Moreover, continued monitoring of the potential reservoirs for this plasmid-mediated colistin resistance is of utmost importance.

Abbreviations

COO: 

Country of origin

DDD: 

Defined daily dose

ESBL: 

Extended-spectrum beta-lactamase

Declarations

Acknowledgements

We would like to thank Prof. Dr. Surbhi Malhorta-Kumar for providing the mcr-2 positive Escherichia coli. In addition, we would like to thank Dr. Tanja Geelen for helpful discussions and Renee Ladestein for the purchase of the retail chicken meat samples.

Availability of data and materials

The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Authors’ contributions

The study was planned and designed by ES, JK, MK, NS, CV and PH. PH collected the samples. NS and CV conducted the experiments. The interpretation of the results was done by ES, JK, MK and PH. The manuscript was prepared by ES and JK. All authors contributed to and commented on the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The author(s) declare(s) that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Laboratory for Microbiology and Infection Control, Amphia Hospital
(2)
Academy for Technology and Environmental Health, Avans University of Applied Sciences
(3)
Laboratory for Medical Microbiology and Immunology, Elisabeth-TweeSteden Hospital
(4)
Julius Centre for Health Sciences and Primary Care, University Medical Center Utrecht
(5)
Amphia Academy Infectious Disease Foundation, Amphia Hospital
(6)
Department of Medical Microbiology and Infection Control, VU University Medical Center

References

  1. Liu YY, Wang Y, Walsh TR, Yi LX, Zhang R, Spencer J, Doi Y, Tian G, Dong B, Huang X, et al. Emergence of plasmid-mediated colistin resistance mechanism MCR-1 in animals and human beings in China: a microbiological and molecular biological study. Lancet Infect Dis. 2016;16:161–8.View ArticlePubMedGoogle Scholar
  2. Skov RL, Monnet DL. Plasmid-mediated colistin resistance (mcr-1 gene): three months later, the story unfolds. Euro Surveill. 2016;21:30155.View ArticlePubMedGoogle Scholar
  3. Schwarz S, Johnson AP. Transferable resistance to colistin: a new but old threat. J Antimicrob Chemother. 2016;71:2066–70.View ArticlePubMedGoogle Scholar
  4. Yang YQ, Zhang AY, Ma SZ, Kong LH, Li YX, Liu JX, Davis MA, Guo XY, Liu BH, Lei CW, Wang HN. Co-occurrence of mcr-1 and ESBL on a single plasmid in Salmonella enterica. J Antimicrob Chemother. 2016;71:2336–8.View ArticlePubMedGoogle Scholar
  5. Mediavilla JR, Patrawalla A, Chen L, Chavda KD, Mathema B, Vinnard C, Dever LL, Kreiswirth BN. colistin- and carbapenem-resistant Escherichia coli harboring mcr-1 and blaNDM-5, causing a complicated urinary tract infection in a patient from the United States. MBio. 2016;7(4):e01191-16. doi:https://doi.org/10.1128/mBio.01191-16.
  6. Kluytmans-van den Bergh MF, Huizinga P, Bonten MJ, Bos M, De Bruyne K, Friedrich AW, Rossen JW, Savelkoul PH, Kluytmans JA. Presence of mcr-1-positive Enterobacteriaceae in retail chicken meat but not in humans in the Netherlands since 2009. Euro Surveill. 2016;21:30149.View ArticlePubMedGoogle Scholar
  7. Wang Y, Zhang R, Li J, Wu Z, Yin W, Schwarz S, Tyrrell JM, Zheng Y, Wang S, Shen Z, et al. Comprehensive resistome analysis reveals the prevalence of NDM and MCR-1 in Chinese poultry production. Nat Microbiol. 2017;2:16260.View ArticlePubMedGoogle Scholar
  8. Nijhuis RH, Veldman KT, Schelfaut J, Van Essen-Zandbergen A, Wessels E, Claas EC, Gooskens J. Detection of the plasmid-mediated colistin-resistance gene mcr-1 in clinical isolates and stool specimens obtained from hospitalized patients using a newly developed real-time PCR assay. J Antimicrob Chemother. 2016;71:2344–6.View ArticlePubMedGoogle Scholar
  9. Bonten MJ. Antibioticaresistentie: gaat het nu echt mis? Ned Tijdschr Geneeskd. 2016;160:1–3.Google Scholar
  10. Recommendations for MIC determination of colistin (polymyxin E) as recommended by the joint CLSI-EUCAST Polymyxin Breakpoints Working Group [http://www.eucast.org/fileadmin/src/media/PDFs/EUCAST_files/General_documents/Recommendations_for_MIC_determination_of_colistin_March_2016.pdf].
  11. Monte DF, Mem A, Fernandes MR, Cerdeira L, Esposito F, Galvao JA, Franco B, Lincopan N, Landgraf M. Chicken meat as a reservoir of colistin-resistant Escherichia coli strains carrying mcr-1 genes in South America. Antimicrob Agents Chemother. 2017;61(5):e02718-16. doi:https://doi.org/10.1128/AAC.02718-16.
  12. Irrgang A, Roschanski N, Tenhagen BA, Grobbel M, Skladnikiewicz-Ziemer T, Thomas K, Roesler U, Kasbohrer A. Prevalence of mcr-1 in E. coli from livestock and food in Germany, 2010–2015. PLoS One. 2016;11:e0159863.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Consumption of antimicrobial agents and antimicrobial resistance among medically important bacteria in The Netherlands [http://www.swab.nl/swab/cms3.nsf/uploads/4F5A0D8E6F0DD139C1257E6E0051833A/$FILE/NethmapMaran2015%20_webversie.pdf].
  14. Du H, Chen L, Tang YW, Kreiswirth BN. Emergence of the mcr-1 colistin resistance gene in carbapenem-resistant Enterobacteriaceae. Lancet Infect Dis. 2016;16:287–8.View ArticlePubMedGoogle Scholar
  15. Haenni M, Metayer V, Gay E, Madec JY. Increasing trends in mcr-1 prevalence among extended-spectrum-beta-lactamase-producing escherichia coli isolates from french calves despite decreasing exposure to colistin. Antimicrob Agents Chemother. 2016;60:6433–4.View ArticlePubMedPubMed CentralGoogle Scholar
  16. Falgenhauer L, Waezsada SE, Yao Y, Imirzalioglu C, Kasbohrer A, Roesler U, Michael GB, Schwarz S, Werner G, Kreienbrock L, et al. Colistin resistance gene mcr-1 in extended-spectrum beta-lactamase-producing and carbapenemase-producing gram-negative bacteria in Germany. Lancet Infect Dis. 2016;16:282–3.View ArticlePubMedGoogle Scholar
  17. Poirel L, Jayol A, Nordmann P. Polymyxins: antibacterial activity, susceptibility testing, and resistance mechanisms encoded by plasmids or chromosomes. Clin Microbiol Rev. 2017;30:557–96.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2017