Skip to main content

Prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in retail food in Singapore


We characterised 227 Staphylococcus aureus isolates from retail food and food handlers’ gloves samples obtained through food surveillance and risk assessment studies between 2011 and 2014. Of 227 isolates, five (2.2%) were methicillin-resistant and belonged to sequence types ST80 (n = 3) and ST6 (n = 2). All five isolates belonged to SCCmec type IV, were Panton-Valentine leukocidin (pvl)-negative and staphylococcal enterotoxin genes-positive. Resistance to azithromycin was found in ST80 isolates, in addition to resistance to beta-lactams. Our finding of two clinically relevant methicillin-resistant S. aureus (MRSA) strains (ST80 and ST6) in ready-to-eat food and food contact surfaces at retail in Singapore suggests food and food contact surfaces as potential environmental sources of MRSA in the community.

Dear Editor,

Methicillin-resistant Staphylococcus aureus (MRSA) has been recognised as an important nosocomial pathogen and has reportedly been associated with foodborne illnesses [1,2,3]. MRSA has also recently been listed as one of the high-priority antibiotic-resistant pathogens as ranked by the World Health Organisation. In Singapore, surveillance and control programmes of MRSA have been established in various hospitals [4, 5]. However, there is a substantial lack of information on the prevalence of MRSA in food, including at retail. Such information would be useful to better understand the risk of exposure to MRSA through food, particularly ready-to-eat food, in contrast with the more typical known transmission route via contact. Our findings provide preliminary insights on the extent of the spread of MRSA in ready-to-eat food in Singapore.

In this study, we characterised 227 coagulase-positive Staphylococcus aureus strains isolated from retail food and swabs taken from food handlers’ gloves. These isolates and samples were obtained from food surveillance and risk assessment studies conducted between 2011 and 2014. The isolates were confirmed to be S. aureus using coagulase rabbit plasma (Remel), and conventional PCR for the detection of femA gene with modified primers (F- GATCATTTATGGAAGATACGTCAG, R- GATAAAGAAGAAACCAGCAGAGATAG) and PCR conditions from previous studies [6, 7]. To understand the occurrence of methicillin resistance among these S. aureus isolates, we used mecA-PCR for the detection of MRSA, followed by PBP2 latex agglutination test (Oxoid) and disc diffusion with Cefoxitin 30 μg for confirmation. MRSA strains were further characterised by Multi-Locus Sequence Typing (MLST), staphylococcal Protein A (spa) typing, and staphylococcal cassette chromosome (SCCmec) typing. Strains were also analysed for the presence of virulence genes: staphylococcal enterotoxin (sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, seo and sep), Panton-Valentine leukocidin (pvl), exfoliative toxin (eta, etb and etd), and toxic shock syndrome toxin (tsst-1) genes [7, 8]. Antibiotic susceptibility testing was performed and interpreted according to the Clinical and Laboratory Standards Institute (CLSI) guideline [9].

Of the 227 S. aureus isolates, five (2.2%) from two food stalls were methicillin-resistant (Table 1) and belonged to Sequence Types (ST) 80 (spa type t1198) (isolated from sliced onion, prawn fritters, fried egg) and ST6 (spa type t304) (from swabs of food handlers’ gloves) [7]. All five isolates belonged to SCCmec type IV, and were pvl-negative. Unlike SCCmec types I-III strains which are often associated with nosocomial infections, strains belonging to SCCmec type IV are capable of colonising healthy individuals and may be community-associated. Some SCCmec type IV strains may be associated with livestock, suggesting a possible transmission between human and food-producing animals [10,11,12]. In Singapore, community-associated (CA) MRSA strains previously reported were isolated from clinical samples and belonged mainly to ST30, ST59 and ST772 [13]. To our knowledge, no ST6 strain has been reported in Singapore, whereas a ST80 CA-MRSA strain was previously reported in a local hospital in 2003, from a patient with a chin abscess [8]. S. aureus ST80, belonging to Clonal Complex 80 (CC80), was first reported in Denmark in 1993 and has been recognised as a major clone of CA-MRSA, widely spread across Europe [14,15,16]. Most ST80 strains reported elsewhere belong to SCCmec type IV, are pvl-positive, and are usually associated with severe skin/soft tissue infections and necrotising pneumonia [17]. Nonetheless, pvl-negative ST80 strains have also been reported in clinical cases overseas [18, 19]. ST6 MRSA is a double-locus variant of CC5, which is one of the five CCs from which major epidemic MRSA isolates are believed to have emerged [20]. ST6 MRSA was previously reported in human cases and carriers in Australia, Oman and United Arab Emirates (UAE) [16, 21, 22]. In particular, ST6 SCCmec type IV (t304) pvl-negative MRSA, a strain susceptible to non-beta-lactams, was previously isolated from patients overseas, suggesting that the ST6 strain isolated in our study may be capable of causing human infection [23]. In addition, CC6-ST6-t304 strains have previously been isolated from human (MSSA and MRSA), feral cat (MRSA) and camel (MSSA) suggesting that the strain may be transmissible across different host species [19, 24,25,26].

Table 1 Phenotypic and genotypic characteristics of methicillin resistant Staphylococcus aureus (MRSA) isolated from retail food and contact surfaces in Singapore. MLST multi locus sequence typing, spa staphylococcal protein A, pvl panton-valentine leukocidin, se staphylococcal enterotoxin, et exfoliative toxin, tsst-1 toxic shock syndrome toxin-1, AMC amoxycillin-clavulanic acid, AMP ampicillin, FOX cefoxitin, CRO Ceftriaxone, P penicillin, AK amikacin, AZM azithromycin, CIP ciprofloxacin, C chloramphenicol, CN gentamicin, NOR norfloxacin, TE tetracycline, SXT trimethoprim-sulphamethoxazole

In this study, we detected enterotoxin genes seb, sek, and exfoliative toxin gene etd in ST80 strains; and enterotoxin gene sea in ST6 strains [7]. No other toxin genes were detected. Enterotoxins sea and seb are known to cause approximately 90% of staphylococcal food poisoning worldwide [27]. Enterotoxin sek is considered a staphylococcal enterotoxin-like protein, though its ability to cause food poisoning has yet to be demonstrated [28]. etd is an exfoliative toxin serotype known to be associated with mild forms of cutaneous infections such as abscesses and furuncles [29]. The presence of enterotoxin genes (sea and seb) in these MRSA isolates suggests the isolates’ potential to produce toxins, and cause staphylococcal food poisoning, if allowed to grow in sufficient numbers in food. Antimicrobial susceptibility results showed that all 5 MRSA isolates were phenotypically susceptible to amikacin, ciprofloxacin, chloramphenicol, gentamicin, norfloxacin, tetracycline, and trimethoprim/sulfamethoxazole. Susceptibility to at least 3 non-beta-lactams in MRSA is used as a proxy to define community-associated strains [30]. We found ST80 isolates resistant to azithromycin in addition to the beta-lactams tested (Table 1). An emerging trend of macrolide resistance has been reported in CA-MRSA from the human and livestock sectors [11, 31]. MRSA with resistance to additional antibiotic classes is a concern, and may reflect the increasing use of these antibiotics in the local clinical practice, which warrants further investigation.

In conclusion, we report two clinically relevant MRSA strains (ST80 and ST6) in ready-to-eat food and food contact surfaces at retail. Humans (food handlers), rather than animals, were likely the sources of contamination. Our limited findings suggest ready-to-eat food and food contact surfaces as potential environmental sources for colonisation and spread of MRSA in the community. To date, little is known about the transmission of MRSA infections through food and food contact surfaces, however their possible roles in the dissemination of specific MRSA lineages cannot be ruled out. The data warrant a more comprehensive and integrated (farm-to-hospital approach) surveillance of MRSA in Singapore and elsewhere.





Amoxycillin-clavulanic acid








Community-associated methicillin-resistant Staphylococcus aureus







Et :

Exfoliative toxin



mecA :

Gene encoding methicillin-resistant-S. aureus-specific-penicillin-binding protein


Multi-Locus Sequence Typing


Methicillin-resistant Staphylococcus aureus






Penicillin binding protein 2

Pvl :

Panton-valentine leukocidin

SCCmec :

Staphylococcal cassette chromosome

Se :

Staphylococcal enterotoxin


Staphylococcal Protein A


Sequence type





Tsst :

Toxic shock syndrome toxin


  1. Alexandra F, Britta K, Gladys K, Beatriz G-R, Katja A, Jens-Andre H, Annemarie K, Juliane B, Bernd A, Bernd-Alois T. Methicillin susceptible and resistant Staphylococcus aureus from farm to fork impact on food safety. Tehnologija mesa. 2011;1:60–5.

    Google Scholar 

  2. Jones TF, Kellum ME, Porter SS, Bell M, Schaffner W. An outbreak of community-acquired foodborne illness caused by methicillin-resistant Staphylococcus aureus. Emerg Infect Dis. 2002;8(1):82–4.

    Article  PubMed  PubMed Central  Google Scholar 

  3. Kluytmans J, van Leeuwen W, Goessens W, Hollis R, Messer S, Herwaldt L, Bruining H, Heck M, Rost J, Van Leeuwen N. Food-initiated outbreak of methicillin-resistant Staphylococcus aureus analysed by pheno- and genotyping. J Clin Microbiol. 1995;33(5):1121–8.

    CAS  PubMed  PubMed Central  Google Scholar 

  4. Hsu LY, Koh TH, Tan TY, Ito T, Ma XX, Lin RT, et al. Emergence of community-associated methicillin-resistant Staphylococcus aureus in Singapore: a further six cases. Singap Med J. 2006;47(1):20–6.

    CAS  Google Scholar 

  5. Tambyah PA, Kumarasinghe G. Methicillin-resistant Staphylococcus aureus control at the National University Hospital, Singapore: a historical perspective. Ann Acad Med Singap. 2008;37(10):855–60.

    PubMed  Google Scholar 

  6. Veras JF, Carmo LSD, Tong LC, Shupp JW, Cummings C, Santos DAD, Cerqueira MMOP, Cantini A, Nicoli JR, Jett M. A study of the enterotoxigenicity of coagulase-negative and coagulase-positive staphylococcal isolates from food poisoning outbreaks in Minas Gerais, Brazil. Int J Infect Dis. 2008;12:410–5.

    CAS  Article  PubMed  Google Scholar 

  7. Aung KT, Lo JACY, Chau ML, Kang JSL, Yap HM, Gutiérrez RA, Yuk H-G, Ng LC. Microbiological safety assessment and risk mitigation of Indian rojak (deep fried ready-to-eat food) in Singapore. Southeast Asian J Trop Med Public Health. 2016;47(6):1231–45.

    Google Scholar 

  8. Hsu LY, Tristan A, Koh TH, Bes M, Etienne J, Kurup A, Tan TT, Tan BH. Community-associated methicillin-resistant Staphylococcus aureus. Singapore Emerg Infect Dis. 2005;11(2):341–2.

    Article  PubMed  Google Scholar 

  9. Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing: seventeenth informational supplement. Clinical and Laboratory Standards Institute CLSI document. (2007). M100-MS17 [ISBN 1-56238-625-5].

  10. Nemati M, Hermans K, Lipinska U, Denis O, Deplano A, Struelens M, Devriese LA, Pasmans F, Haesebrouck F. Antimicrobial resistance of old and recent Staphylococcus aureus isolates from poultry: first detection of livestock-associated methicillin resistant strain ST398. Antimicrob Agents Chemother. 2008;52(10):3817–9.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  11. Cavaco LM, Miragaia M, Rolo J, Conceicao T, Hasman H, Aarestrup FM, De Lencastre H. Comparison between livestock and community associated MRSA in Europe. Poster session presented at 3rd ASM conference on antimicrobial resistance in Zoonotic bacteria and Foodborne pathogens in animals, humans and the environment, Aix-en-Provence. France.

  12. International Working Group on the Classification of Staphylococcal Cassette Chromosome Elements (IWG-SCC). Classification of staphylococcal cassette chromosome mec (SCCmec): guidelines for reporting novel SCCmec elements. Antimicrob Agents Chemother. 2009;53(12):4961–7.

    Article  Google Scholar 

  13. Wijaya L, Hsu LY. Community-associated methicillin-resistant Staphylococcus aureus skin and soft tissue infections. Proc Singapore Healthc. 2010;19(3):212–9.

    Article  Google Scholar 

  14. Faria NA, Oliveira DC, Westh H, Monnet DL, Larsen AR, Skov R, De Lencastre H. Epidemiology of emerging methicillin-resistant Staphylococcus aureus (MRSA) in Denmark: a nationalwide study in a country with low prevalence of MRSA infection. J Clin Microbiol. 2005;43:1836–42.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  15. Stam-Bolink EM, Mithoe D, Baas WH, Arends JP, Moller AV. Spread of a methicillin-resistant Staphylococcus aureus ST80 strain in the community of the northern-Netherlands. Eur J Clin Microbiol Infect Dis. 2007;26:723–7.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  16. Deurenberg RH, Stobberingh EE. The evolution of Staphylococcus aureus. Infect Genet Evol. 2008;8:747–63.

    CAS  Article  PubMed  Google Scholar 

  17. Budimir A, Deurenberg RH, Bosnjak Z, Stobberingh EE, Cetkovic H, Kalenic S. A variant of the southern German clone of methicillin-resistant Staphylococcus aureus is predominant in Croatia. Clin Microbiol Infect. 2010;16(8):1077–83.

    CAS  Article  PubMed  Google Scholar 

  18. Djoudi F, Bonura C, Benallaoua S, Touati A, Touati D, Aleo A, Cala C, Fasciana T, Mammina C. Panton-valentine leukocidin positive sequence type 80 methicillin-resistant Staphylococcus aureus carrying a staphylococcal cassette chromosome mec type IVc is dominant in neonates and children in an Algiers hospital. New Microbiol. 2013;36:49–56.

    PubMed  Google Scholar 

  19. Monecke S, Coombs G, Shore AC, Coleman DC, Akpaka P, Borg M, Chow H, Ip M, Jatzwauk L, et al. A field guide to pandemic, epidemic and sporadic clones of methicillin-resistant Staphylococcus aureus. PLoS One. 2011;6(4):e17936.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  20. Enright MC, Robinson DA, Randle G, Feil EJ, Grundmann H, Spratt BG. The evolutionary history of methicillin-resistant Staphylococcus aureus (MRSA). Proc Natll Acad Sci USA. 2002;99(11):7687–92.

    CAS  Article  Google Scholar 

  21. Monecke S, Skakni L, Hasan R, Ruppelt A, Ghazal SS, Hakawi A, Slickers P, Ehricht R. Characterisation of MRSA strains isolated from patients in a hospital in Riyadh, Kingdom of Saudi Arabia. BMC Microbiol. 2012;12:146–54.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  22. Weber S, Ehricht R, Slickers P, Abdel-Wareth L, Donnelly G, Pitout M, Stefan M. Genetic fingerprinting of MRSA from Abu Dhabi. Vienna. Eur J Clin Microbiol Infect Dis. 2010;2010

  23. Udo EE, Al-Lawati BA-H, Al-Muharmi Z, Thukral SS. Genotyping of methicillin-resistant Staphylococcus aureus in the Sultan Qaboos University Hospital, Oman reveals the dominance of Panton-valentine leucocidin-negative ST6-IV/t304 clone. New Microbes New Infect. 2014;2(4):100–5.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  24. Sonnevend Á, Blair I, Alkaabi M, Jumaa P, Al Haj M, Ghazawi A, Akawi N, Jouhar FS, Hamadeh MB, et al. Change in methicillin resistant Staphylococcus aureus clones at a tertiary care hospital in the United Arab Emirates over a 5-year period. J Clin Pathol. 2012;65:178–82.

    Article  PubMed  Google Scholar 

  25. Harastani HH, Tokajian ST. Community-associated methicillin-resistant Staphylococcus aureus clonal complex 80 type IV (CC80-MRSA-IV) isolated from the Middle East: a heterogeneous expanding clonal lineage. PLoS One. 2014;9:1–11.

    Article  Google Scholar 

  26. Bierowiec K, Ploneczka-Janeczko K, Rypula K. Is the colonisation of Staphylococcus aureus in pets associated with their close contact with owners? PLoS One. 2016;11(5):e0156052.

    Article  PubMed  PubMed Central  Google Scholar 

  27. Pinchuk IV, Beswick EJ, Reyes VE. Staphylococcal enterotoxins. Toxins (Basel). 2010;2(8):2177–97.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  28. Argudin MA, Mendoza MC, Rodicio MR. Food poisoning and Staphylococcus aureus enterotoxins. Toxins (Basel). 2010;2(7):1751–73.

    CAS  Article  Google Scholar 

  29. Yamasaki O, Tristan A, Yamaguchi T, Sugai M, Lina G, Bes M, Vandenesch F, Etienne J. Distribution of the exfoliative toxin D gene in clinical Staphylococcus aureus isolates in France. Clin Microbiol Infect. 2006;12(6):585–8.

    CAS  Article  PubMed  Google Scholar 

  30. David MZ, Daum RS. Community-associated methicillin-resistant Staphylococcus aureus: epidemiology and clinical consequences of an emerging epidemic. Clin Microbiol Rev. 2010;23(3):616–87.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  31. Como-Sabetti K, Harriman KH, Buck JM, Glennen A, Boxud DJ, Lynfield R. Community-associated methicillin-resistant Staphylococcus aureus: trends in case and isolate characteristics from six years of prospective surveillance. Public Health Rep. 2009;124(3):427–35.

    Article  PubMed  PubMed Central  Google Scholar 

Download references


Not applicable.


This study was funded by the National Environment Agency, Singapore.

Availability of data and materials

Please contact corresponding author for data requests.

Author information

Authors and Affiliations



KTA, LYH, HCH and RAG were involved in the conception and design of the study. KTA, MLC and THK performed the identification and characterisation of isolates. KTA, LYH, THK, HCH, RAG and LCN were involved in the analysis and interpretation of the data. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Ramona Alikiiteaga Gutiérrez.

Ethics declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Aung, K.T., Hsu, L.Y., Koh, T.H. et al. Prevalence of methicillin-resistant Staphylococcus aureus (MRSA) in retail food in Singapore. Antimicrob Resist Infect Control 6, 94 (2017).

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI:


  • Methicillin-resistant Staphylococcus aureus (MRSA)
  • Retail food
  • Food contact surface
  • Antibiotic resistance
  • Enterotoxin genes
  • Panton-valentine leukocidin (pvl) gene