Characterization of the novel In1059 harbouring VIM gene cassette
- Dongguo Wang†1Email author,
- Jinhong Yang†2,
- Meiyu Fang†3,
- Wei He†4,
- Ying Zhang4,
- Caixia Liu2 and
- Dongsheng Zhou5, 1Email author
https://doi.org/10.1186/s13756-017-0204-1
© The Author(s). 2017
Received: 10 February 2017
Accepted: 3 May 2017
Published: 18 May 2017
Abstract
Background
VIM-type enzyme encodes the most widely acquired metallo-β-lactamases in Gram- negative bacteria. To obtain current epidemiological data for integrons from enterobacteriae in hospital, the study characterizes the genetic structure in In1059 by comparison with In846 integrons harbouring VIM gene and other class 1 integrons including In37, In62, In843 and In1021 with the aim of identifying the putative mechanisms involved integron mobilization and infer evolution of relevant integrons.
Methods
Six of 69 recombinant plasmids from clinical strains were found to be class 1 integrons by digestion with BamHI, drug susceptibility testing, conjugation experiments, PCR amplification, integron cloning and sequencing, genome comparison, and detection of carbapenemase activity.
Results
The sequences of the six recombinant plasmids encoding In1021, In843, In846, In37, In62, and the novel In1059 integron had approximate lengths of ~4.8-, 4.1-, 5.1-, 5.3-, 5.3- and 6.6- kb, respectively. The genetic structures of these integrons were mapped and characterized, and the carbapenemase activities of their parental strains were assessed.
Conclusions
Our results suggest that the six variable integron structures and regular variations that exist in the gene cassettes provide a putative mechanism for the integron changes. Our study has also shown that the genetic features in the integrons named above fall within a scheme involving the stepwise and parallel evolution of class 1 integron variation likely under antibiotic selection pressure in clinical settings.
Keywords
Background
Multidrug resistance can occur by the acquisition of DNA, and the horizontal transfer of drug-resistance genes or drug-resistance gene arrays from one cell to another also occurs and this process transfers drug resistance genes via plasmids and transposons. In recent years, most of the resistance genes found on the plasmids and transposons of Gram-negative bacilli have been found to be integrated into DNA elements called integrons [1]. These integrons contain potential mobile genetic elements that feature a site-specific recombination system capable of integrating and expressing gene cassette structures in the host bacterium [2].
Integrons are the most efficient genetic elements in terms of their ability to disseminate drug-resistance genes between bacteria [3]. Depending on the sequence of the intI gene, integrons have been confirmed to be many classes, and only class 1, 2 and 3 integrons were first identified association with mobile genetic elements [4], intIA with chromosomal integrons and VchintIA with V. cholerae chromosomal integrons [5]. By capturing exogenous cassettes and ensuring expression of the captive genes, an integron plays important role in the horizontal dissemination of antibiotic-resistance genes [6–8]. The mechanisms of integration and excision of gene casettes are well described with integrations known to occur at attI × attC recombination sites [9, 10], and excisions requiring attC × attC recombination sites, which occur in single-stranded sequences and activate the folded bottom strand [11, 12]. Because of their linkage with transposons or being plasmid encoded, class 1 integrons can capture genetic structures, express gene cassettes, and facilitate their own mobility, but they are incapable of self-mobilization [5, 13].
Integrons usually contain three functional components: an integrase gene (intI), a primary recombination site (attI), and an outward-orientated promoter (P C ) [14]. Cassette integrations occur mainly at the attI site and this ensures the expression of the captured cassettes under the control of the P C promoter [7, 15]. For most class 1 integrons, the 5′-CS regions are similar and include intI and attI genes; however, differences exist in the 3′-CS sequences and the three open reading frames (ORFs) [16].
VIM-type metallo-β-lactamases were first isolated from Pseudomonas aeruginosa and other Gram-negative nonfermenting bacteria in Europe [17–20]. These enzymes were subsequently observed worldwide in Gram-negative nonfermentative bacteria and in Enterobacteriaceae. Class 1 integrons harbouring VIM-type gene cassettes have spread among various Gram-negative pathogens [21]. Therefore, this study aimed to characterize the genetic structures of the novel In1059 integron by comparison with the In846 integron and other structural class 1 integrons from enterobacteriaceae in terms of the VIM-type gene cassettes. From this analysis, we have also identified the described mechanism underlying integron mobilization, revealing the relations amongst structures of class 1 integrons including novel In1059 and other integrons in the study.
Methods
Clinical bacterial isolates and drug susceptibility testing
In total, 69 non-redundant multidrug-resistant enterobacteria strains, including non-typhoidal Salmonella Nsa243 and Nsa217 (harbouring In37 and In1021), Enterobacter cloacae Ecl175 (In843), Klebsiella pneumoniae Kpn761 and Kp3349 (In62 and novel In1059), and Enterobacter aerogenes Eae634 (In846), were recovered from hospitalized patients with clinical infections. The strains were assessed for integrons at the Taizhou Municipal Hospital of China (July 2013 to July 2015). Bacterial species was identified by 16 S rRNA gene sequencing [22]. All the above integron-harbouring isolates, plus Escherichia coli TOP10 (Invitrogen, USA), were used in the study. E. coli TOP10 was used as the host for the cloning experiments and for susceptibility testing experiments.
The minimum inhibitory concentration (MIC) values of 12 antimicrobial agents, including cephalosporins (cefazolin, ceftazidime and ceftriaxone), aminoglycosides (netilmicin, tobramycin and amikacin), carbapenems (ertapenem, meropenem and imipenem), and quinolones (norfloxacin, ofloxacin and ciprofloxacin), were determined using drug susceptibility plates and the Microscan broth dilution method (Microscan, Washington, USA). The MICs were interpreted according to the Clinical and Laboratory Standards Institute guidelines [23].
Plasmid digestion, integron cloning and DNA sequencing
Plasmids from six integron-harbouring isolates were collected using an AxyPrep Plasmid Miniprep kit (Axygen Biosciences, Beijing, China) according to the manufacturer’s instructions and according to Wang et al., 2014 [24]. The plasmids were digested with BamHI (TaKaRa, Dalian, China), and the six integron-harbouring recombinant plasmids were electrophoretically resolved to generate genetic maps.
Primers used for PCR amplification and sequencing
Primer | Sequence (5′-3′) | Length (bp) | Reference | |
---|---|---|---|---|
5′-CS | F | GGCATCCAAGCAGCAAGC | Variable | [40] |
3′-CS | R | AAGCAGACTTGACCTGAT | ||
Int1 | F | AGCACCTTGCCGTAGAAGAACAG | 3500 | This study |
R | GTCATAATCGGTTATGGCATCGC | |||
intI1 | F | GGGTCAAGGATCTGGATTTCG | 1250 | [33] |
R | ACATGCGTGTAAATCATCGTCG | |||
sul1 | F | ATGGTGACGGTGTTCGGCATTCTGA | 900 | [34] |
R | TCTGGCTCCCAATCTAGTACGGATC | |||
qacEΔ1 | F | ATCGCAATAGTTGGCGAAGT | 600 | [35] |
R | CAAGCTTTTGCCCATGAAGC | |||
aadA | F | ACATCATTCCGTGGCGTTATC | 1100 | This study |
R | TTATTTGCCGACTACCTTGGTGA | |||
tnpA | F | GGCGGGATCTGCTTGTAGAG | 920 | [36] |
R | CTCCGGAGATGTCTGGCTTACT | |||
aad B | F | TCACAGCCAAACTATCAGG | 857 | This study |
R | TGCTCCACCAATCACAAT | |||
aacA4 | F | TGACCAACAGCAACGATTCC | 800 | [37] |
R | TTAGGCATCACTGCGTGTTC | |||
bla OXA | F | ATGAAAAACACAATACATATCAACTTCGC | 900 | This study |
R | GTGTGTTTAGAATGGTGATCGCATT | |||
bla KPC | F | TGTCACTGTATCGCCGTC | 1000 | [31] |
R | CTCAGTGCTCTACAGAAAACC | |||
bla TEM | F | CTGTCTATTTCGTTCATCC | 1061 | [24] |
R | CTCAGTATTGCCCGCTCC | |||
bla VIM | F | CACGAACCCAGTGGACATA | 1512 | This study |
R | TCACAGTAACCAGCAAATCA | |||
bla IMP | F | GCACGAACCCAGTTGACATA | 1394 | This study |
R | GTTTCTTCTTCCCACCATCC | |||
tniC | F | GCTCTGGTTGAGTTGGTG | 993 | This study |
R | GGATCCTTCCGCCTGTTG | |||
dfr | F | GTGAAAATATCACTAATGG | 750 | [38] |
R | TTAACCCCTTTGCCAGATTTG | |||
arr-3 | F | GGTGACTTGCTAACCACAG | 450 | This study |
R | ACAGTGACATAGCAAGTTCAG | |||
catB | F | CCTGAAGATTGCCAAGAGTGGT | 980 | [39] |
R | AGTTTGTTCAGGGTGACGAAGG |
Sequence annotation and genome comparison
ORFs were predicted with RAST (http://rast.nmpdr.org/) and further annotated using BLASTP and BLASTN programs (https://blast.ncbi.nlm.nih.gov/Blast.cgi) against UniProtKB/Swiss-Prot (http://web.expasy.org/docs/swiss-prot_guideline.html) and National Center for Biotechnology NR databases (https://www.ncbi.nlm.nih.gov/). Database annotation of drug-resistance genes, mobile elements and other genes was based on CARD (http://arpcard.mcmaster.ca), the β-lactamase (http://www.ncbi.nlm.nih.gov/pathogens/submit_beta_lactamase) database, ISfinder (https://www-is.biotoul.fr/), and INTEGRALL (http://integrall.bio.ua.pt/?). Sequence comparisons were performed with BLASTN and CLUSTALW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/). Gene organisation diagrams were drawn with Inkscape (https://inkscape. org).
Carbapenemase activity detection
The activities of A, B and D carbapenemase classes in the bacterial cell extracts for the above mentioned six isolates were determined using a modified CarbaNP test [26]. Overnight bacterial cell cultures in Mueller-Hinton (MH) broth were each diluted 1:100 into 3 mL of fresh MH broth, and the bacteria were grown at 37 °C with shaking at 200 rpm to reach OD600s of 1.0 to 1.4. When required, ampicillin was used (200 μg/mL). Bacterial cells were harvested from 2 mL of each culture, and each pellet from the individual cultures was washed twice with 20 mM Tris-HCl (pH 7.8). Each cell pellet was resuspended in 500 μL of 20 mM Tris-HCl (pH 7.8), lysed by sonication and spun at 10000×g at 4 °C for 5 min. Each 50 μL supernatant (containing the enzymatic bacterial suspension fraction) was mixed with 50 μL of the following substrates (I to V), followed by incubation at 37 °C for a maximum of 2 h: substrate I: 0.054% phenol red plus 0.1 mM ZnSO4 (pH 7.8), substrate II: 0.054% phenol red plus 0.1 mM ZnSO4 (pH 7.8), and 0.6 mg/μL imipenem, substrate III: 0.054% phenol red plus 0.1 mM ZnSO4 (pH 7.8), 0.6 mg/μL imipenem, and 0.8 mg/μL tazobactam, substrate IV: 0.054% phenol red plus 0.1 mM ZnSO4 (pH 7.8), 0.6 mg/μL imipenem, and 3 mM EDTA (pH 7.8), and substrate V: 0.054% phenol red plus 0.1 mM ZnSO4 (pH 7.8), 0.6 mg/μL imipenem, 0.8 mg/μL tazobactam, and 3 mM EDTA (pH 7.8).
Nucleotide sequence accession numbers
In1021 Nsa217, In843 Ecl175, In846 Eae634, In37 Nsa243, and In62 Kpn761 sequences, along with In1059 Kp3349, a novel sequence, were deposited in GenBank under the accession numbers KR338349, KR338350, KR338351, KR338352, KJ716225 and KM589496, respectively.
Results and discussion
Integron cloning experiments and antibiotic susceptibility testing
Antimicrobial drug susceptibility profiles
Strains | Plasmids | Antibiotic susceptibility testing (mg/L) | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Cephalosporins | Carbapenems | Aminoglycosides | Fluoroquinolones | ||||||||||
CZ | CAZ | CTX | ETM | MPM | IPM | NET | TOB | AK | NOR | OFL | CIP | ||
Nsa243 | In37 | 256/R | 128/R | 128/R | 16/R | 16/R | 8/R | 64/R | 32/R | 128/R | 0.10/S | 0.05/S | 0.25/S |
In37-TOP10 | 16/R | 8/R | 8/R | 8/R | 8/R | 4/R | 16/R | 16/R | 32/R | 0.05/S | 0.003/S | 0.125/S | |
TOP10 | 1/S | 0.5/S | 0.5/S | 0.5/S | 0.5/S | 0.25/S | 2/S | 0.025/S | 1/S | 0.05/S | 0.003/S | 0.125/S | |
Ecl175 | In843 | 2/S | 1/S | 1/S | 0.5/S | 0.5/S | 0.25/S | 512/R | 128/R | 512/R | 0.10/S | 0.05/S | 0.25/S |
In843-TOP10 | 1/S | 0.5/S | 0.5/S | 0.25/S | 0.25/S | 0.125/S | 128/R | 64/R | 128/R | 0.05/S | 0.003/S | 0.125/S | |
TOP10 | 1/S | 0.5/S | 0.5/S | 0.5/S | 0.5/S | 0.25/S | 64/R | 32/R | 64/R | 0.05/S | 0.003/S | 0.125/S | |
Kpn761 | In62 | 2/S | 1/S | 1/S | 0.5/S | 0.5/S | 0.25/S | 128/R | 64/R | 128/R | 0.10/S | 0.05/S | 0.25/S |
In62-TOP10 | 1/S | 0.5/S | 0.5/S | 0.25/S | 0.25/S | 0.125/S | 64/R | 32/R | 32/R | 0.05/S | 0.003/S | 0.125/S | |
TOP10 | 1/S | 0.5/S | 0.5/S | 0.5/S | 0.5/S | 0.25/S | 2/S | 0.025/S | 1/S | 0.05/S | 0.003/S | 0.125/S | |
Nsa217 | In1021 | 2/S | 1/S | 1/S | 0.5/S | 0.5/S | 0.25/S | 256/R | 128/R | 256/R | 0.10/S | 0.05/S | 0.25/S |
In1021-TOP10 | 1/S | 0.5/S | 0.5/S | 0.25/S | 0.25/S | 0.125/S | 128/R | 64/R | 128/R | 0.05/S | 0.003/S | 0.125/S | |
TOP10 | 1/S | 0.5/S | 0.5/S | 0.5/S | 0.5/S | 0.25/S | 2/S | 0.025/S | 1/S | 0.05/S | 0.003/S | 0.125/S | |
Eae634 | In846 | 256/R | 128/R | 128/R | 64/R | 64/R | 64/R | 128/R | 64/R | 128/R | 0.10/S | 0.05/S | 0.25/S |
In846-TOP10 | 64/R | 16/R | 16/R | 16/R | 16/R | 16/R | 64/R | 32/R | 64/R | 0.05/S | 0.003/S | 0.125/S | |
TOP10 | 1/S | 0.5/S | 0.5/S | 0.5/S | 0.5/S | 0.25/S | 2/S | 0.025/S | 1/S | 0.05/S | 0.003/S | 0.125/S | |
KP3349 | In1059 | 256/R | 128/R | 128/R | 64/R | 64/R | 128/R | 64/R | 128/R | 64/R | 0.10/S | 0.05/S | 0.25/S |
In1059-TOP10 | 32/R | 16/R | 16/R | 16/R | 16/R | 64/R | 32/R | 16/R | 16/R | 0.05/S | 0.003/S | 0.125/S | |
TOP10 | 1/S | 0.5/S | 0.5/S | 0.5/S | 0.5/S | 0.25/S | 2/S | 0.025/S | 1/S | 0.05/S | 0.003/S | 0.125/S |
Electrophoretogram of recombinant plasmids encoding In1021, In843, In846, In37, In62, and novel In1059 with genetic mapping. Lane M, λHindIII DNA marker (Amersham Biosciences, Shanghai, China). Lane 1, recombinant plasmids encoding In1021 from the isolate Nsa217 estimated to be approximately 4.8 kb-long; lane 2, recombinant plasmid encoding In843 from the isolate Ecl175 estimated to be approximately 4.1 kb-long; lane 3, recombinant plasmid encoding In846 from the isolate Eae634 estimated to be approximately 5.1 kb-long; lane 4, recombinant plasmid encoding In37 from the isolate Nsa243 estimated to be approximately 5.3 kb-long; lane 5, recombinant plasmid encoding In62 from the isolate Kpn761 estimated to be approximately 5.3 kb-long; lane 6, recombinant plasmid encoding novel In1059 from the isolate Kp3349 estimated to be approximately 6.6 kb-long
Strain carbapenemase activities and genetic features of integrons
The following strains (transformants) In37-TOP10, In846-TOP10 and In1059-TOP10 have class D, B and B carbapenemase activities, respectively, while In37 (isolate Nsa243) appears to have class D activity, while In846 (Eae634) and In1059 (Kp3349) appear to have class B activities, respectively (data not shown). All the above strains were resistant to the cephalosporin, carbapenem and aminoglycoside drugs but they were susceptible to fluoroquinolones (Table 2). In62 apparently represents the most primitive form among these integrons. In62 carries two different resistance markers, while In37, In843, In846, In1021 and In1059 have evolved to capture the determinants of at least three different antibiotic classes, and they most likely confer MDR.
Comparison of novel In1059 with other integrons in the study
Integron | In1059 | In846 | In843 | In37 | In62 | In1021 |
---|---|---|---|---|---|---|
Pc variant | PcH1 | PcH1 | None | None | PcH1 | PcH1 |
“-35”: tggaca | “-35”: tggaca | “-35”: tggaca | “-35”: ggacat | |||
“-35”: taaact | “-10”: taaact | “-10”: ttcgta | “-10”: taaact | |||
P2 promoter | Absent | Absent | Absent | Absent | Absent | Absent |
PintI1 | Yes | Yes | Yes | Yes | Yes | Yes |
“-10”: agtcta | “-10”: agtcta | “-10”: agggcg | “-10”: agtcta | “-10”: agtcta | “-10”: agtcta | |
“-35”: cagcaa | “-35”: cagcaa | “-35”: catcgt | “-35”: cagcaa | “-35”: cagca | “-35”: cagcaa | |
19 bp ORF11 duplication | No | No | No | No | No | No |
intI1 | IntI1 R32_H39 | IntI1 R32_H39 | Remant of intI1 | Remant of intI1 | IntI1 R32_H39 | IntI1 R32_H39 |
1010 bp-length | 1014 bp-length | 4 bp-length | 720 bp-length | 1014 bp-length | 1014 bp-length | |
attI1 | 63 bp-length | 63 bp-length | 63 bp-length | 63 bp-length | 63 bp-length | 63 bp-length |
Array of gene cassettes | GCbla VIM-5 - GCaacA4’-37- (tniC-aadA16)- (qacE 30 -aadB) | GCbla VIM-1 - GCaacA4cr- (qacE 101-catB3) - GCarr-3 | GCaacA4cr - GCarr-3 - GCdfrA27 - (qacE 101-aadA16Δ::IS26) | GCaacA4cr - GCbla OXA-1 - GCcatB3 - GCarr-3 | GCaacA4cr | GCaacA4cr - (qacE 109 -arr-3) - GCdfrA27 - (qacE 30 -aadA16) |
attC | attCbla VIM-5(L;R) attC aacA4Δ(LΔ; R); attC aadA16/aacA4(L;R); attC aadBΔ(L; Del) | attCbla VIM-1(L;R); attC aacA4cr(L;R); attC catB3 (L;R); attC aacA4(LΔ; R) | attC aacA4cr (L; R); attC arr-3 (L;R); attC dfrA27 (L;R); attC aadA16 (L;R) | attC aacA4cr (L;R); attCbla OXA-1(L;R); attC catB3 (L;R); attC arr-3 (L; R) | attC aacA4cr (L; R) | attC aacA4cr (L;R); attC arr-3 (L; R); attC dfrA27 (L; R); attC aadA16(L;R) mutated |
3′-CS | qacEΔ1-sul1 | qacEΔ1 (partial) | qacEΔ1 (partial) | qacEΔ1-sul1 | qacEΔ1-sul1 | IS15-sul1Δ-IS1 |
Integron comparisons based on BamHI digestion of plasmids. Genes are denoted by arrows and colours based on the gene function classifications. Shaded areas denote regions with >99% nucleotide sequence identity, with the exception of >97% for the comparison of GCaacA4cr in In846 and GCaacA4′-37 in novel In1059. A, Comparison of In37, In843, In62, In1021, In846 and novel In1059 integrons after BamHI digestion. B-a, Comparison of integrons In37, novel In1059 and transposon Tn1696 (DQ310703); B-b, Comparison of integrons In846, novel In1059 and transposon Tn7017 (KJ571202). The novel In1059 integron shares higher sequence identity with integron Tn7017 than with integron Tn1696
Genetic structures and proposed mobilization and evolution of In0 to In1059 and the analysis of intI1 and attC in class 1 integrons from this study. I, genetic structures and putative mobilization. A, In0; B, A + GCaadB; C, B + GCaadA16; D, C + GCaacA4’-3; E, In1059 = D + GCbla VIM-5 + IS26 + (sul1 + orf5) (replacing sulΔ1); II, Sequences and structures of attI1 (59-be, 59-base elements) and attC. II-a, the attI1 (59-be) site positions are denoted by the bold black line. Open bars indicate potential IntI1 recognition sites, and arrows under the 7-bp core sites indicate relative orientations. The 7-bp core site sequences are shown in bold type, and the strong and weak IntI1-binding sites and direct repeats, DR1 and DR2, are indicated in accordance with the literature [29]. The simple site locations are denoted by an open bar. The “aacaaag(a)” sequences in the black boxes are reminiscent of the spacer in attI1 and occur between the two gene cassettes; recombination or excision of gene cassettes occurs frequently at these sites as indicated in panel I, process C to D. II-b, the attC sequences of class 1 integrons. The bold black letters denote the 7-bp core site, while the numbers are the nucleotide positions (left, negative, right, positive) of the recombination cross-over points, as indicated by a vertical arrow where the recombination or excision of gene cassettes regularly occurs, as shown in panel I. The GenBank accession numbers are shown on the left-hand side of the diagram
Sequence comparisons of InV117 [28] (part of Tn1696, GenBank accession number DQ310703), In1059 and In37 reveal high levels of sequence homology among them (Fig. 2B-a), and In37 in particular shares high sequence identity with In1059. Because the Tn1696 module (including InV117) has the potential to transpose, this suggests that In37 and In1059 should also potentially be mobile elements. Compared with In70 [20] (part of Tn7017, GenBank accession number KJ571202), In1059 and In843 share the most sequence homology with In70 (Fig. 2B-b), and this is especially so for novel In1059. These results provide new insight about the structure of In1059, which coupled with the known plasticity of the In70 genetic context in the recombination plasmids, means that this might have mediated mobilization of the bla VIM-1-containing In70 integron platform [21].
Mobilization and evolutionary inferences for In0 to In1059
Generally, In0 could emerge from excision of all cassettes of an integron. If In0 captures GCaadB on attI1 site likely under antibiotic pressure, structure A might be transferred to structure B, maybe becoming a novel integron (Fig. 3I); then, likely under similar conditions, if joining with GCaadA16, structure B might become structure C, too (Fig. 3I); Also, if joined by GCaacA4’-3, structure C might turn into structure D, perhaps involving a novel integron as well; meanwhile, if inserted into GCbla VIM-5 on attI1 site and IS26 on site between GCaadB and qacE1, then, replaced sul1Δ with sul1 and orf5, structure D will convert into structure E, likely under the right conditions, just as novel In1059 assigned in the study (Fig. 3 and Table 3 and Additional file 1). According to Collis et al., 1998 [29], the recombination or excision of gene cassettes from class 1 integrons frequently occurs at sites of vertical arrow (Fig. 3II-a) between the ″aacaaag(a)″ array and its next nucleotide in attI1, and sites of vertical arrow (Fig. 3II-b) between ″g″ and ″t″ of ″gtttrrry″ array in attC; however, the study appears slightly mutant sequences in terms of the cross-over point of attI1 and attC (Fig. 3II-a and b). Integrons are associated with MDR in Gram-negative bacteria [30, 31, 32] and have been determined as the primary source of drug-resistance genes, and they are also suspected to be reservoirs of drug-resistance genes in patients with bacterial infections [20].
Conclusions
Antibiotic overuse makes it likely that more and more MDR strains will appear in clinical isolates, and most of these strains will contain class 1 integrons. The features of the integrons described above denote a scheme involving the stepwise and parallel evolution of class 1 integron variation likely under antibiotic selection pressure in clinical settings.
Declarations
Acknowledgements
We are grateful to Professor Thomas Jové (INTEGRALL curator), for his designation of In1021, In843, In846, In37, In62 and the novel In1059 integron, all of which are registered in the INTEGRALL database.
Funding
This work was supported by grants from the Foundation of Department of Science and Technology of Zhejiang Province (2014C33153), the Foundation of Zhejiang Health Department (2014KYB218 and 2017KY717) and the Foundation of Taizhou Science and Technology Bureau (14SF05,1301KY36 and 1201KY22).
Availability of data and materials
Please contact author for data requests.
Authors’ contributions
Conceived and designed the experiments: DW. Performed the experiments: all authors. Analyzed the data: DW and DZ. Contributed to the writing of the manuscript: DW. Read and approved the final manuscript: all authors.
Competing interests
The authors declare that they have no competing interests.
Consent for publication
Not applicable.
Ethics approval and consent to participate
The use of patient specimens and all related experimental protocols were approved by the Committee on Human Research at the institutions indicated. The study was carried out in accordance with the approved guidelines of the Ethics Committee of our Hospital, China.
Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Authors’ Affiliations
References
- Hall RM. Gene cassettes and integrons: moving single genes. In: Syvanen M, Kado CI, editors. Horizontal gene transfer. 2nd ed. San Diego: Academic Press; 2002. p. 19–28.Google Scholar
- Leverstein-van Hall MA, M Blok HE, T Donders AR, Paauw A, Fluit AC, Verhoef J. Multidrug resistance among Enterobacteriaceae is strongly associated with the presence of integrons and is independent of species or isolate origin. J Infect Dis. 2003;187:251–9.View ArticlePubMedGoogle Scholar
- Huang L-Y, Chen T-L, Lu P-L, Tsai C-A, Cho W-L, Chang F-Y, et al. Dissemination of multidrug-resistant, class 1 integron-carrying Acinetobacter baumannii isolates in Taiwan. Clin Microbiol Infect. 2008;14:1010–9.View ArticlePubMedGoogle Scholar
- Partridge SR, Tsafnat G, Coiera E, Iredell JR. Gene cassettes and cassette arrays inmobile resistance integrons. FEMS Microbiol Rev. 2009;33:757–84.View ArticlePubMedGoogle Scholar
- Mazel D. Integrons: agents of bacterial evolution. Nat Rev Microbiol. 2006;4:608–20.View ArticlePubMedGoogle Scholar
- Hall RM, Stokes HW. Integrons: novel DNA elements which capture genes by site-specific recombination. Genetica. 1993;90:115–32.View ArticlePubMedGoogle Scholar
- Collis CM, Hall RM. Expression of antibiotic resistance genes in the integrated cassettes of integrons. Antimicrob Agents Chemother. 1995;39:155–62.View ArticlePubMed CentralPubMedGoogle Scholar
- Hall RM, Collis CM. Antibiotic resistance in gram-negative bacteria: the role of gene cassettes and integrons. Drug Resist Updat. 1998;1:109–19.View ArticlePubMedGoogle Scholar
- MacDonald D, Demarre G, Bouvier M, Mazel D, Gopaul DN. Structural basis for broad DNA-specificity in integron recombination. Nature. 2006;440:1157–62.View ArticlePubMedGoogle Scholar
- Loot C, Ducos-Galand M, Escudero JA, Bouvier M, Mazel D. Replicative resolution of integron cassette insertion. Nucleic Acids Res. 2012;40:8361–70.View ArticlePubMed CentralPubMedGoogle Scholar
- Bouvier M, Demarre G, Mazel D. Integron cassette insertion: a recombination process involving a folded single strand substrate. EMBO J. 2005;24:4356–67.View ArticlePubMed CentralPubMedGoogle Scholar
- Bouvier M, Ducos-Galand M, Loot C, Bikard D, Mazel D. Structural features of single-stranded integron cassette attC sites and their role in strand selection. PLoS Genet. 2009;5:e1000632.View ArticlePubMed CentralPubMedGoogle Scholar
- Carattoli A. Plasmid-mediated antimicrobial resistance in Salmonella Enterica. Curr Issues Mol Biol. 2003;5:113–22.PubMedGoogle Scholar
- Collis CM, Kim MJ, Stokes HW, Hall RM. Integron-encoded IntI integrases preferentially recognize the adjacent cognate attI site in recombination with a 59-be site. Mol Microbiol. 2002;46:1415–27.View ArticlePubMedGoogle Scholar
- Levesque C, Brassard S, Lapointe J, Roy PH. Diversity and relative strength of tandem promoters for the antibiotic-resistance genes of several integrons. Gene. 1994;142:49–54.View ArticlePubMedGoogle Scholar
- Stokes HW, Hall RM. A novel family of potentially mobile DNA elements encoding site-specific gene integration functions: integrons. Mol Microbiol. 1989;3:1669–83.View ArticlePubMedGoogle Scholar
- Lauretti L, Riccio ML, Mazzariol A, Cornaglia G, Amicosante G, Fontana R, et al. Cloning and characterization of bla VIM, a new integron-borne metallo-β-lactamase gene from a Pseudomonas aeruginosa clinical isolate. Antimicrob Agents Chemother. 1999;43:1584–90.PubMed CentralPubMedGoogle Scholar
- Poirel L, Naas T, Nicolas D, Collet L, Bellais S, Cavallo JD, et al. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-β-lactamase and its plasmid-and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob Agents Chemother. 2000;44:891–7.View ArticlePubMed CentralPubMedGoogle Scholar
- Riccio ML, Pallecchi L, Fontana R, Rossolini GM. In70 of plasmid pAX22, a bla VIM-1-containing integron carrying a new aminoglycoside phosphor-transferase gene cassette. Antimicrob Agents Chemother. 2001;45:1249–53.View ArticlePubMed CentralPubMedGoogle Scholar
- Tsakris A, Pournaras S, Woodford N, Palepou MF, Babini GS, Douboyas J, et al. Outbreak of infections caused by Pseudomonas aeruginosa producing VIM-1 carbapenemase in Greece. J Clin Microbiol. 2000;38:1290–2.PubMed CentralPubMedGoogle Scholar
- Di Pilato V, Pollini S, Rossolini GM. Characterization of plasmid pAX22, encoding VIM-1 metallo-β-lactamase, reveals a new putative mechanism of In70 integron mobilization. J Antimicrob Chemother. 2014;69:67–71.View ArticlePubMedGoogle Scholar
- Frank JA, Reich CI, Sharma S, Weisbaum JS, Wilson BA, Olsen GJ. Critical evaluation of two primers commonly used for amplification of bacterial 16S rRNA genes. Appl Environ Microbiol. 2008;74:2461–70.View ArticlePubMed CentralPubMedGoogle Scholar
- Clinical and Laboratory Standards Institute. Performance standards for antimicrobial susceptibility testing, document M100–25. Wayne: Clinical and Laboratory Standards Institute; 2015.Google Scholar
- Wang D, Hou W, Chen J, Mou Y, Yang L, Yang L, et al. Characterization of the bla KPC-2 and bla KPC-3 genes and the novel bla KPC-15 gene in Klebsiella pneumoniae. J Med Microbiol. 2014;63:981–7.View ArticlePubMedGoogle Scholar
- Wang M, Tran JH, Jacoby GA, Zhang Y, Wang F, Hooper DC. Plasmid-mediated quinolone resistance in clinical isolates of Escherichia coli from shanghai, China. Antimicrob Agents Chemother. 2003;47:2242–8.View ArticlePubMed CentralPubMedGoogle Scholar
- Chen Z, Li H, Feng J, Li Y, Chen X, Guo X, et al. NDM-1 encoded by a pNDM- BJ01-like plasmid p3SP-NDM in clinical Enterobacter aerogenes. Front Microbiol. 2015;6:294.PubMed CentralPubMedGoogle Scholar
- Raherison S, Jove T, Gaschet M, Pinault E, Tabesse A, Torres C, Ploy MC. Expression of the aac(6′)-Ib-cr gene in class 1 integrons. Antimicrob Agents Chemother. 2017;61(5):e02704–16. [Epub ahead of print]View ArticlePubMedGoogle Scholar
- Soler Bistué AJ, Martín FA, Petroni A, Faccone D, Galas M, Tolmasky ME, et al. Vibrio cholerae InV117, a class 1 integron harbouring aac(6′)-Ib and bla CTX-M-2, is linked to transposition genes. Antimicrob Agents Chemother. 2006;50:1903–7.View ArticlePubMed CentralPubMedGoogle Scholar
- Collis CM, Kim M-J, Stokes HW, Hall RM. Binding of the purified integron DNA integrase IntI1 to integron and cassette-associated recombination sites. Mol Microbiol. 1998;29:477–90.View ArticlePubMedGoogle Scholar
- Ochman H, Lawrencem JG, Groisman EA. Lateral gene transfer and the nature of bacterial innovation. Nature. 2000;405:299–304.View ArticlePubMedGoogle Scholar
- Sallen B, Rajoharison A, Desvarenne S, Mabilat C. Molecular epidemiology of integron-associated antibiotic resistance genes in clinical isolates of Entero- bacteriaceae. Microb Drug Resist. 1995;1:95–202.View ArticleGoogle Scholar
- Kitchel B, Rasheed JK, Patel JB, Srinivasan A, Navon-Venezia S, Brolund A, et al. Molecular epidemiology of KPC-producing Klebsiella pneumoniae isolates in the United States: clonal expansion of multilocus sequence type 258. Antimicrob Agents Chemother. 2009;53:3365–70.View ArticlePubMed CentralPubMedGoogle Scholar
- Mazel D, Dychinco B, Webb VA, Davies J. Antibiotic resistance in the EcoR collection: integrons and identification of a novel aad gene. Antimicrob Agents Chemother. 2000;44:1568–74.View ArticlePubMed CentralPubMedGoogle Scholar
- Grape M, Farra A, Kronvall G, Sundstrom L. Integrons and gene cassettes in clinical isolates of co-trimoxazole-resistant gram-negative bacteria. Clinic Microbiol Infect. 2005;11:185–92.View ArticleGoogle Scholar
- Sandvang D, Aarestrup FM, Jensen LB. Characterisation of integrons and antibiotic resistance genes in Danish multiresistant Salmonella enterica Typhimurium DT104. FEMS Microbiol Lett. 1997;157:177–81.View ArticlePubMedGoogle Scholar
- Han HS, Koh YJ, Hur J-S, Jung JS. Occurrence of the strA-strB streptomycin resistance genes in Pseudomonas species isolated from kiwifruit plants. J Microbiol. 2004;42:365–8.PubMedGoogle Scholar
- Fihman V, Lartigue MF, Jacquier H, Meunier F, Schnepf N, Raskine L, et al. Appearance of aac(6′)-Ib-cr gene among extended-spectrum β-lactamase- producing Enterobacteriaceae in a French hospital. J Inf Secur. 2008;56:454–9.Google Scholar
- Wei Q, Jiang X, Yang Z, Chen N, Chen X, Li G, et al. dfrA27, a new integron- associated trimethoprim resistance gene from Escherichia coli. J Antimicrob Chemother. 2009;63:405–19.View ArticlePubMedGoogle Scholar
- Cámara B, Bielecki P, Kaminski F, dos Santos VM, Plumeier I, Nikodem P, et al. A gene cluster involved in degradation of substituted salicylates via ortho cleavage in Pseudomonas sp. strain MT1 encodes enzymes specifically adapted for transformation of 4-methylcatechol and 3-methylmuconate. J Bacteriol. 2007;189:1664–74.View ArticlePubMedGoogle Scholar
- Levesque C, Piche L, Larose C, Roy PH. PCR mapping of integrons reveals several novel combinations of resistance genes. Antimicrob Agents Chemother. 1995;39:185–91.View ArticlePubMed CentralPubMedGoogle Scholar